Gene Page:SIAH1

Summary?
GeneID 6477
Symbol SIAH1
Synonyms SIAH1A
Description siah E3 ubiquitin protein ligase 1
Reference MIM:602212|HGNC:HGNC:10857|Ensembl:ENSG00000196470|HPRD:03736|Vega:OTTHUMG00000175417
Gene type protein-coding
Map location 16q12.1
Pascal p-value 0.071
Sherlock p-value 0.378
Fetal beta 1.794
DMG 1 (# studies)
eGene Cerebellar Hemisphere
Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
GSMA_IIE Genome scan meta-analysis (European-ancestry samples) Psr: 0.01775
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg09123773 16 48419537 SIAH1 4.476E-4 -0.464 0.045 DMG:Wockner_2014

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs7960097 chr12 51526736 SIAH1 6477 0.13 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
MMRN2 0.80 0.81
LRRC32 0.79 0.80
CXorf36 0.75 0.77
SLCO2B1 0.75 0.77
TGM2 0.74 0.75
VWF 0.72 0.76
TLN1 0.72 0.68
CSPG4 0.70 0.76
CD34 0.70 0.73
ENG 0.70 0.74
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
MTERFD3 -0.51 -0.56
SNHG12 -0.51 -0.55
ANAPC4 -0.51 -0.53
C6orf203 -0.50 -0.51
NDUFAF2 -0.50 -0.54
ST20 -0.50 -0.57
C8orf59 -0.50 -0.60
MTIF3 -0.50 -0.54
FRG1 -0.49 -0.52
PDCD5 -0.48 -0.49

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0016874 ligase activity IEA -
GO:0016881 acid-amino acid ligase activity IEA -
GO:0008270 zinc ion binding IDA 11863358
GO:0008022 protein C-terminus binding 新闻学会 11389840
GO:0046872 metal ion binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007411 axon guidance TAS axon (GO term level: 13) 9334332
GO:0007399 nervous system development TAS neurite (GO term level: 5) 9334332
GO:0006508 proteolysis TAS 9334332
GO:0006511 ubiquitin-dependent protein catabolic process IEA -
GO:0007283 spermatogenesis IEA -
GO:0007049 cell cycle IEA -
GO:0009653 anatomical structure morphogenesis TAS 9403064
GO:0006915 apoptosis TAS 9403064
GO:0007275 multicellular organismal development IEA -
GO:0030154 cell differentiation IEA -
GO:0030163 protein catabolic process IDA 11389840
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -
GO:0005737 cytoplasm TAS 9334332

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
AFF4 AF5Q31 | MCEF | MGC75036 AF4/FMR2 family, member 4 Two-hybrid BioGRID 16189514
APC BTPS2 | DP2 | DP2.5 | DP3 | GS adenomatous polyposis coli - HPRD,BioGRID 11389840
BAG1 RAP46 BCL2-associated athanogene - HPRD,BioGRID 9582267
CACYBP GIG5 | MGC87971 | PNAS-107 | RP1-102G20.6 | S100A6BP | SIP calcyclin binding protein - HPRD,BioGRID 11389839
DAB1 - disabled homolog 1 (Drosophila) - HPRD,BioGRID 12646221
DCC CRC18 | CRCR1 deleted in colorectal carcinoma - HPRD,BioGRID 9858595
DCC CRC18 | CRCR1 deleted in colorectal carcinoma DCC interacts with Siah-1. BIND 9334332
DCC CRC18 | CRCR1 deleted in colorectal carcinoma hSiah1 interacts with DCC cytoplasmic domain. BIND 9334332
EIF3J EIF3S1 | eIF3-alpha | eIF3-p35 eukaryotic translation initiation factor 3, subunit J - HPRD,BioGRID 9822659
KHDRBS3 Etle | SALP | SLM-2 | SLM2 | T-STAR | TSTAR | etoile KH domain containing, RNA binding, signal transduction associated 3 - HPRD,BioGRID 15163637
KIF22 KID | KNSL4 | OBP | OBP-1 | OBP-2 kinesin family member 22 - HPRD,BioGRID 11146551
NUMB S171 numb homolog (Drosophila) - HPRD,BioGRID 11752454
PEG10 Edr | HB-1 | KIAA1051 | MEF3L | Mar2 | Mart2 | RGAG3 paternally expressed 10 - HPRD,BioGRID 12810624
PEG3 DKFZp781A095 | KIAA0287 | PW1 | ZSCAN24 paternally expressed 3 - HPRD,BioGRID 10681424
POU2AF1 BOB1 | OBF-1 | OBF1 | OCAB POU class 2 associating factor 1 - HPRD,BioGRID 11483517|11483518
RBBP8 CTIP | RIM retinoblastoma binding protein 8 Affinity Capture-Western
Reconstituted Complex
Two-hybrid		 BioGRID 14654780
SIAH1 FLJ08065 | HUMSIAH | Siah-1 | Siah-1a | hSIAH1 seven in absentia homolog 1 (Drosophila) - HPRD,BioGRID 9582267
SKP1 EMC19 | MGC34403 | OCP-II | OCP2 | SKP1A | TCEB1L | p19A S-phase kinase-associated protein 1 - HPRD 11389839
SYP - synaptophysin - HPRD,BioGRID 11786535
TBL1X EBI | SMAP55 | TBL1 transducin (beta)-like 1X-linked - HPRD,BioGRID 11389839
TUBA1A B-ALPHA-1 | FLJ25113 | LIS3 | TUBA3 tubulin, alpha 1a - HPRD 11146551
TUBA1B K-ALPHA-1 tubulin, alpha 1b - HPRD 11146551
TUBA3C TUBA2 | bA408E5.3 tubulin, alpha 3c - HPRD 11146551
TUBA4A FLJ30169 | H2-ALPHA | TUBA1 tubulin, alpha 4a - HPRD 11146551
TUBA8 TUBAL2 tubulin, alpha 8 - HPRD 11146551
UBE2D1 E2(17)KB1 | SFT | UBC4/5 | UBCH5 | UBCH5A ubiquitin-conjugating E2D酶1 (UBC4/5同族体, yeast) - HPRD,BioGRID 11389839
UBE2E3 UBCH9 | UbcM2 ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) Two-hybrid BioGRID 11389839
UBE2I C358B7.1 | P18 | UBC9 ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) Ubc9 interacts with Siah-1. BIND 9334332
UBE2I C358B7.1 | P18 | UBC9 ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) hSiah1 interacts with Ubc9. BIND 9334332
VAV1 VAV vav 1 guanine nucleotide exchange factor Two-hybrid BioGRID 10207103


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG P53 SIGNALING PATHWAY 69 45 All SZGR 2.0 genes in this pathway
KEGG UBIQUITIN MEDIATED PROTEOLYSIS 138 98 All SZGR 2.0 genes in this pathway
KEGG WNT SIGNALING PATHWAY 151 112 All SZGR 2.0 genes in this pathway
REACTOME DEVELOPMENTAL BIOLOGY 396 292 All SZGR 2.0 genes in this pathway
REACTOME AXON GUIDANCE 251 188 All SZGR 2.0 genes in this pathway
REACTOME NETRIN1 SIGNALING 41 30 All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER DN 406 230 All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED UP 78 48 All SZGR 2.0 genes in this pathway
BILBAN B CLL LPL UP 63 39 All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN 485 334 All SZGR 2.0 genes in this pathway
LAU APOPTOSIS CDKN2A UP 55 40 All SZGR 2.0 genes in this pathway
GRAESSMANNAPOPTOSIS BY DOXORUBICIN UP 1142 669 All SZGR 2.0 genes in this pathway
IIZUKA LIVER CANCER PROGRESSION G1 G2 DN 25 18 All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP 555 346 All SZGR 2.0 genes in this pathway
WANG TARGETS OF MLL CBP FUSION UP 44 26 All SZGR 2.0 genes in this pathway
GENTILE UV RESPONSE CLUSTER D4 55 37 All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV SCC DN 123 86 All SZGR 2.0 genes in this pathway
GENTILE UV HIGH DOSE DN 312 203 All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY GAMMA AND UV RADIATION 88 65 All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE UP 226 164 All SZGR 2.0 genes in this pathway
WONG PROTEASOME GENE MODULE 49 35 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP 673 430 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN 593 372 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN 591 366 All SZGR 2.0 genes in this pathway
MATZUK SPERMATOCYTE 72 55 All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB UP 245 159 All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS DN 435 289 All SZGR 2.0 genes in this pathway
MONTERO THYROID CANCER POOR SURVIVAL DN 11 6 All SZGR 2.0 genes in this pathway
RATTENBACHER BOUND BY CELF1 467 251 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-129-5p 988 995 1A,m8 hsa-miR-129brain CUUUUUGCGGUCUGGGCUUGC
hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGCU
miR-135 390 396 m8 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUG
miR-140 198 204 m8 hsa - mir - 140brain AGUGGUUUUACCCUAUGGUAG
miR-141/200a 25 31 m8 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
hsa-miR-200a UAACACUGUCUGGUAACGAUGU
miR-15/16/195/424/497 446 452 m8 hsa-miR-15abrain UAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brain UAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrain UAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZ UAGCAGCACAGAAAUAUUGGC
hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497 CAGCAGCACACUGUGGUUUGU
miR-193 22 28 m8 hsa-miR-193a AACUGGCCUACAAAGUCCCAG
hsa-miR-193b AACUGGCCCUCAAAGUCCCGCUUU
miR-200bc/429 942 948 m8 hsa-miR-200b UAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200c UAAUACUGCCGGGUAAUGAUGG
hsa-miR-429 UAAUACUGUCUGGUAAAACCGU
miR-205 112 118 m8 hsa-miR-205 UCCUUCAUUCCACCGGAGUCUG
miR-299-5p 196 203 1A,m8 hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU
miR-30-3p 203 210 1A,m8 hsa-miR-30a-3p CUUUCAGUCGGAUGUUUGCAGC
hsa-miR-30e-3p CUUUCAGUCGGAUGUUUACAGC
miR-329 466 472 1A hsa-miR-329brain AACACACCUGGUUAACCUCUUU
miR-381 901 907 m8 hsa - mir - 381 UAUACAAGGGCAAGCUCUCUGU
miR-450 988 994 1A hsa-miR-450 UUUUUGCGAUGUGUUCCUAAUA
miR-486 143 149 1A hsa-miR-486 UCCUGUACUGAGCUGCCCCGAG
miR-488 1030 1036 m8 hsa-miR-488 CCCAGAUAAUGGCACUCUCAA