Gene Page:BMP7

Summary?
GeneID 655
Symbol BMP7
Synonyms OP-1
Description bone morphogenetic protein 7
Reference MIM:112267|HGNC:HGNC:1074|Ensembl:ENSG00000101144|HPRD:00212|Vega:OTTHUMG00000032812
Gene type protein-coding
Map location 20q13
Pascal p-value 0.596
Fetal beta 0.281
DMG 2 (# studies)
eGene Myers' cis & trans
Meta

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 4
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 4
Expression Meta-analysis of gene expression Pvalue: 1.368
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg23420286 20 55835350 BMP7 1.85E-4 0.65 0.034 DMG:Wockner_2014
cg15069906 20 55841888 BMP7 3.458E-4 -0.285 0.041 DMG:Wockner_2014
cg20292547 20 55841342 BMP7 4.364E-4 -0.2 0.045 DMG:Wockner_2014
cg00340850 20 55500523 BMP7 1.29E-10 -0.027 4.83E-7 DMG:Jaffe_2016

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs6849842 chr4 185436254 BMP7 655 0.03 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
KIAA1219 0.95 0.97
TAOK1 0.94 0.96
BRAF 0.94 0.96
VCPIP1 0.94 0.96
ZYG11B 0.94 0.96
RLIM 0.93 0.96
DENND5B 0.93 0.96
NUFIP2 0.93 0.96
SEL1L 0.92 0.94
ZBTB44 0.92 0.94
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
FXYD1 -0.66 -0.75
HIGD1B -0.62 -0.74
TLCD1 -0.62 -0.70
C19orf36 -0.62 -0.67
S100A16 -0.61 -0.70
CST3 -0.60 -0.70
AC021016.1 -0.60 -0.68
MT-CO2 -0.60 -0.72
SERPINB6 -0.60 -0.66
ENHO -0.60 -0.72

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005125 cytokine activity IEA -
GO:0005515 protein binding 新闻学会 12478285|12667445
GO:0008083 growth factor activity IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007411 axon guidance IEA axon (GO term level: 13) -
GO:0001503 ossification IEA -
GO:0001707 mesoderm formation IEA -
GO:0001837 epithelial to mesenchymal transition TAS 14679171
GO:0001822 kidney development IEA -
GO:0009887 organ morphogenesis IEA -
GO:0048468 cell development IEA -
GO:0007435 salivary gland morphogenesis IEA -
GO:0007389 pattern specification process IEA -
GO:0042475 odontogenesis of dentine-containing tooth IEA -
GO:0030501 positive regulation of bone mineralization IDA 18436533
GO:0030509 BMP信号帕特hway IEA -
GO:0051216 cartilage development IEA -
GO:0048754 branching morphogenesis of a tube IEA -
GO:0040007 growth IEA -
GO:0045941 positive regulation of transcription IDA 14517293
GO:0045786 negative regulation of cell cycle IDA 11502704
GO:0045669 positive regulation of osteoblast differentiation IDA 18436533
GO:0048593 camera-type eye morphogenesis IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005576 extracellular region IEA -
GO:0005615 extracellular space IEA -

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
ACVR1 ACTRI | ACVR1A | ACVRLK2 | ALK2 | FOP | SKR1 | TSRI activin A receptor, type I - HPRD,BioGRID 8006002
ACVR2A ACTRII | ACVR2 activin A receptor, type IIA - HPRD,BioGRID 9748228
ACVR2B ACTRIIB | ActR-IIB | MGC116908 activin A receptor, type IIB - HPRD,BioGRID 9748228
BMP7 OP-1 bone morphogenetic protein 7 Co-purification BioGRID 12478285
BMPR1A 10q23del | ACVRLK3 | ALK3 | CD292 骨形态形成蛋白受体,IA型 Reconstituted Complex BioGRID 8006002
BMPR1A 10q23del | ACVRLK3 | ALK3 | CD292 骨形态形成蛋白受体,IA型 - HPRD 7791754|8605097
BMPR1B ALK-6 | ALK6 | CDw293 bone morphogenetic protein receptor, type IB - HPRD 8605097
BMPR1B ALK-6 | ALK6 | CDw293 bone morphogenetic protein receptor, type IB Reconstituted Complex BioGRID 8006002
BMPR2 BMPR-II | BMPR3 | BMR2 | BRK-3 | FLJ41585 | FLJ76945 | PPH1 | T-ALK bone morphogenetic protein receptor, type II (serine/threonine kinase) - HPRD,BioGRID 7791754
ENG CD105 | END | FLJ41744 | HHT1 | ORW | ORW1 endoglin - HPRD,BioGRID 9872992
NCOA3 ACTR | AIB-1 | AIB1 | CAGH16 | CTG26 | KAT13B | MGC141848 | RAC3 | SRC3 | TNRC14 | TNRC16 | TRAM-1 | pCIP nuclear receptor coactivator 3 - HPRD 7791754
NOG SYM1 | SYNS1 noggin - HPRD,BioGRID 12478285
SMAD1 BSP1 | JV4-1 | JV41 | MADH1 | MADR1 SMAD家庭成员1 Phenotypic Suppression BioGRID 11438941
SOSTDC1 CDA019 | DKFZp564D206 | ECTODIN | USAG1 sclerostin domain containing 1 - HPRD,BioGRID 14623234|15020244


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG CYTOKINE CYTOKINE RECEPTOR INTERACTION 267 161 All SZGR 2.0 genes in this pathway
KEGG HEDGEHOG SIGNALING PATHWAY 56 42 All SZGR 2.0 genes in this pathway
KEGG TGF BETA SIGNALING PATHWAY 86 64 All SZGR 2.0 genes in this pathway
BIOCARTA ALK PATHWAY 37 29 All SZGR 2.0 genes in this pathway
PID BMP PATHWAY 42 31 All SZGR 2.0 genes in this pathway
PID ALK2 PATHWAY 11 9 All SZGR 2.0 genes in this pathway
HOLLMANN APOPTOSIS VIA CD40 DN 267 178 All SZGR 2.0 genes in this pathway
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN 493 298 All SZGR 2.0 genes in this pathway
DOANE RESPONSE TO ANDROGEN UP 184 125 All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS UP 372 227 All SZGR 2.0 genes in this pathway
WANG CLIM2 TARGETS UP 269 146 All SZGR 2.0 genes in this pathway
JAEGER METASTASIS DN 258 141 All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL DN 118 79 All SZGR 2.0 genes in this pathway
HUMMEL BURKITTS LYMPHOMA UP 43 27 All SZGR 2.0 genes in this pathway
PROVENZANI METASTASIS DN 136 94 All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 3 DN 229 142 All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP 584 356 All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174 695 All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS DN 193 112 All SZGR 2.0 genes in this pathway
LI WILMS TUMOR VS FETAL KIDNEY 2 DN 51 42 All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM2 153 102 All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM3 70 37 All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 1652 1023 All SZGR 2.0 genes in this pathway
GOUYER TATI TARGETS DN 17 12 All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS 988 594 All SZGR 2.0 genes in this pathway
BENPORATH OCT4 TARGETS 290 172 All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS 734 436 All SZGR 2.0 genes in this pathway
BENPORATH NOS TARGETS 179 105 All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS DN 357 212 All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 20Q12 Q13 AMPLICON 149 76 All SZGR 2.0 genes in this pathway
PENG LEUCINE DEPRIVATION UP 142 93 All SZGR 2.0 genes in this pathway
BASSO CD40 SIGNALING DN 68 44 All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY NO BLOOD DN 150 93 All SZGR 2.0 genes in this pathway
NIELSEN GIST VS SYNOVIAL SARCOMA UP 19 12 All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY DN 145 88 All SZGR 2.0 genes in this pathway
LU AGING BRAIN UP 262 186 All SZGR 2.0 genes in this pathway
XU GH1 AUTOCRINE TARGETS UP 268 157 All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN 434 302 All SZGR 2.0 genes in this pathway
BANDRES RESPONSE TO CARMUSTIN MGMT 48HR DN 161 105 All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP 566 371 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 482 296 All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER P2 79 55 All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER P6 91 44 All SZGR 2.0 genes in this pathway
SANSOM APC MYC TARGETS 217 138 All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS REQUIRE MYC 210 123 All SZGR 2.0 genes in this pathway
SANSOM WNT PATHWAY REQUIRE MYC 58 43 All SZGR 2.0 genes in this pathway
STEIN ESRRA TARGETS DN 105 63 All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 3D DN 270 181 All SZGR 2.0 genes in this pathway
FUJII YBX1 TARGETS DN 202 132 All SZGR 2.0 genes in this pathway
CHENG IMPRINTED BY ESTRADIOL 110 68 All SZGR 2.0 genes in this pathway
MCCABE BOUND BY HOXC6 469 239 All SZGR 2.0 genes in this pathway
ENGELMANN CANCER PROGENITORS DN 70 44 All SZGR 2.0 genes in this pathway
MCCABE HOXC6 TARGETS UP 10 8 All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE UP 149 85 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069 729 All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED 351 238 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 491 319 All SZGR 2.0 genes in this pathway
GYORFFY DOXORUBICIN RESISTANCE 56 34 All SZGR 2.0 genes in this pathway
STEIN ESRRA TARGETS 535 325 All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN 306 191 All SZGR 2.0 genes in this pathway
NIELSEN LEIOMYOSARCOMA CNN1 DN 20 18 All SZGR 2.0 genes in this pathway
BAE BRCA1 TARGETS UP 75 47 All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR DN 505 328 All SZGR 2.0 genes in this pathway
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 UP 134 85 All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP 745 475 All SZGR 2.0 genes in this pathway
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7 403 240 All SZGR 2.0 genes in this pathway
MALIK REPRESSED BY ESTROGEN 12 10 All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP 489 314 All SZGR 2.0 genes in this pathway
NABA SECRETED FACTORS 344 197 All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED 753 411 All SZGR 2.0 genes in this pathway
NABA MATRISOME 1028 559 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-542-3p 438 444 1A hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA