Gene Page:SNCA

Summary?
GeneID 6622
Symbol SNCA
Synonyms NACP|PARK1|PARK4|PD1
Description synuclein alpha
Reference MIM:163890|HGNC:HGNC:11138|Ensembl:ENSG00000145335|HPRD:01227|Vega:OTTHUMG00000130948
Gene type protein-coding
Map location 4q21
Pascal p-value 0.012
Sherlock p-value 0.516
Fetal beta -1.991
DMG 1 (# studies)
Support G2Cdb.human_clathrin
G2Cdb.human_Synaptosome

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Nishioka_2013 Genome-wide DNA methylation analysis The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. 1
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 7
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0635

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg15452573 4 90758843 SNCA -0.019 0.77 DMG:Nishioka_2013


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
PALLD 0.91 0.84
NR2E1 0.87 0.78
NOTCH1 0.86 0.81
SOX2 0.86 0.84
YAP1 0.85 0.75
AL161668.2 0.85 0.83
LTBP1 0.85 0.74
SIX5 0.84 0.67
FBXL7 0.84 0.80
TGIF2 0.84 0.69
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
SERPINI1 -0.31 -0.28
C5orf53 -0.31 -0.30
RERGL -0.30 -0.35
CHN1 -0.30 -0.20
SERGEF -0.30 -0.32
TMEM155 -0.29 -0.26
CA4 -0.29 -0.26
NRSN1 -0.29 -0.25
NDUFB9 -0.29 -0.39
ZFAND2A -0.29 -0.33

Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0042802 identical protein binding IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007417 central nervous system development TAS Brain (GO term level: 6) 9197268
GO:0048169 regulation of long-term neuronal synaptic plasticity IEA neuron, Synap (GO term level: 10) -
GO:0001963 synaptic transmission, dopaminergic IEA neuron, Synap, Neurotransmitter, dopamine (GO term level: 8) -
GO:0048489 synaptic vesicle transport IEA neuron, Synap (GO term level: 6) -
GO:0001956 positive regulation of neurotransmitter secretion IEA Neurotransmitter (GO term level: 10) -
GO:0042416 dopamine biosynthetic process IEA Neurotransmitter, dopamine (GO term level: 9) -
GO:0006644 phospholipid metabolic process IEA -
GO:0006916 anti-apoptosis TAS 10818098
GO:0042493 response to drug IEA -
GO:0040012 regulation of locomotion IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0019717 synaptosome IEA Synap, Brain (GO term level: 7) -
GO:0005634 nucleus IEA -
GO:0005737 cytoplasm TAS 8248242
GO:0016020 membrane IEA -

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
APP AAA | ABETA | ABPP | AD1 | APPI | CTFgamma | CVAP | PN2 amyloid beta (A4) precursor protein - HPRD,BioGRID 9163350
BAD BBC2 | BCL2L8 BCL2-associated agonist of cell death Reconstituted Complex BioGRID 11742726
BAD BBC2 | BCL2L8 BCL2-associated agonist of cell death - HPRD 10407019
BAX BCL2L4 BCL2-associated X protein Reconstituted Complex BioGRID 11742726
BCL2L1 BCL-XL/S | BCL2L | BCLX | Bcl-X | DKFZp781P2092 | bcl-xL | bcl-xS BCL2-like 1 - HPRD 11742726
CALM1 CALML2 | CAMI | DD132 | PHKD calmodulin 1 (phosphorylase kinase, delta) - HPRD,BioGRID 12358748
COL25A1 CLAC | CLACP collagen, type XXV, alpha 1 - HPRD 15522881
CPOX CPO | CPX | HCP coproporphyrinogen oxidase - HPRD,BioGRID 12059041
CYCS CYC | HCS cytochrome c, somatic - HPRD 10506125
ELK1 - ELK1, member of ETS oncogene family - HPRD 11279280
FYN MGC45350 | SLK | SYN FYN oncogene related to SRC, FGR, YES - HPRD,BioGRID 11162638
GRK1 GPRK1 | RHOK | RK G protein-coupled receptor kinase 1 Biochemical Activity BioGRID 10852916
GRK5 GPRK5 G protein-coupled receptor kinase 5 Biochemical Activity BioGRID 10852916
GRK6 FLJ32135 | GPRK6 G protein-coupled receptor kinase 6 Biochemical Activity BioGRID 10852916
LAMP2 CD107b | LAMPB | LGP110 lysosomal-associated membrane protein 2 alpha-synuclein interacts with lamp2a. This interaction was modeled on a demonstrated interaction between human alpha-synuclein and rat lamp2a. BIND 15333840
MAP1B DKFZp686E1099 | DKFZp686F1345 | FLJ38954 | FUTSCH | MAP5 microtubule-associated protein 1B - HPRD,BioGRID 10764738
MAPK1 ERK | ERK2 | ERT1 | MAPK2 | P42MAPK | PRKM1 | PRKM2 | p38 | p40 | p41 | p41mapk mitogen-activated protein kinase 1 Affinity Capture-Western BioGRID 12121974
MAPK1 ERK | ERK2 | ERT1 | MAPK2 | P42MAPK | PRKM1 | PRKM2 | p38 | p40 | p41 | p41mapk mitogen-activated protein kinase 1 - HPRD 11279280
MAPK3 ERK1 | HS44KDAP | HUMKER1A | MGC20180 | P44ERK1 | P44MAPK | PRKM3 mitogen-activated protein kinase 3 Affinity Capture-Western BioGRID 12121974
MAPK8 JNK | JNK1 | JNK1A2 | JNK21B1/2 | PRKM8 | SAPK1 mitogen-activated protein kinase 8 Affinity Capture-Western BioGRID 12121974
MAPK8IP1 IB1 | JIP-1 | JIP1 | PRKM8IP mitogen-activated protein kinase 8 interacting protein 1 - HPRD 11790792
MAPT DDPAC | FLJ31424 | FTDP-17 | MAPTL | MGC138549 | MSTD | MTBT1 | MTBT2 | PPND | TAU microtubule-associated protein tau - HPRD,BioGRID 10464279
PARK2 AR-JP | LPRS2 | PDJ | PRKN Parkinson disease (autosomal recessive, juvenile) 2, parkin - HPRD,BioGRID 11588587
PLD1 - phospholipase D1, phosphatidylcholine-specific - HPRD,BioGRID 11821392
PRKCE MGC125656 | MGC125657 | PKCE | nPKC-epsilon protein kinase C, epsilon - HPRD 10407019
SEPT2 DIFF6 | KIAA0158 | NEDD5 | Pnutl3 | hNedd5 septin 2 Affinity Capture-Western BioGRID 12695511
SEPT4 ARTS | BRADEION | CE5B3 | H5 | MART | PNUTL2 | SEP4 | hCDCREL-2 | hucep-7 septin 4 Affinity Capture-Western BioGRID 12695511
SLC6A3 DAT | DAT1 solute carrier family 6 (neurotransmitter transporter, dopamine), member 3 Alpha-synuclein interacts with hDAT. BIND 14550771
SLC6A3 DAT | DAT1 solute carrier family 6 (neurotransmitter transporter, dopamine), member 3 - HPRD,BioGRID 12672538
SNCAIP MGC39814 | SYPH1 synuclein, alpha interacting protein Affinity Capture-Western
FRET
Reconstituted Complex
Two-hybrid		 BioGRID 10319874|11331421
|11742726|12044636
SNCAIP MGC39814 | SYPH1 synuclein, alpha interacting protein SNCAIP interacts with SNCA. BIND 10319874
SNCAIP MGC39814 | SYPH1 synuclein, alpha interacting protein - HPRD 10319874|11331421
|12044636
SNCB - synuclein, beta - HPRD,BioGRID 11683992
SQSTM1 A170 | OSIL | PDB3 | ZIP3 | p60 | p62 | p62B sequestosome 1 - HPRD 11447312
TH TYH tyrosine hydroxylase - HPRD 11943812
TOR1A DQ2 | DYT1 torsin family 1, member A (torsin A) - HPRD,BioGRID 11438481
TUBA1A B-ALPHA-1 | FLJ25113 | LIS3 | TUBA3 tubulin, alpha 1a - HPRD 11687285
UCHL1 PARK5 | PGP9.5 | Uch-L1 ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) - HPRD 11603807
YWHAB GW128 | HS1 | KCIP-1 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide - HPRD 10407019
YWHAE 14-3-3E | FLJ45465 | KCIP-1 | MDCR | MDS tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide - HPRD 10407019


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG ALZHEIMERS DISEASE 169 110 All SZGR 2.0 genes in this pathway
KEGG PARKINSONS DISEASE 133 78 All SZGR 2.0 genes in this pathway
BIOCARTA PARKIN PATHWAY 13 8 All SZGR 2.0 genes in this pathway
PID ALPHA SYNUCLEIN PATHWAY 33 25 All SZGR 2.0 genes in this pathway
REACTOME AMYLOIDS 83 63 All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA DN 526 357 All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP 1382 904 All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN 536 332 All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL DN 226 132 All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER GRADES 1 2 DN 67 43 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP 633 376 All SZGR 2.0 genes in this pathway
HAHTOLA SEZARY SYNDROM UP 98 58 All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES SKIN UP 177 113 All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES UP 19 15 All SZGR 2.0 genes in this pathway
TANG SENESCENCE TP53 TARGETS UP 33 20 All SZGR 2.0 genes in this pathway
XU HGF TARGETS INDUCED BY AKT1 48HR DN 27 17 All SZGR 2.0 genes in this pathway
DAIRKEE TERT TARGETS UP 380 213 All SZGR 2.0 genes in this pathway
CEBALLOS TARGETS OF TP53 AND MYC DN 38 31 All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM1 229 137 All SZGR 2.0 genes in this pathway
AMIT SERUM RESPONSE 20 MCF10A 21 10 All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 DN 464 276 All SZGR 2.0 genes in this pathway
LE EGR2 TARGETS DN 108 84 All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP 398 262 All SZGR 2.0 genes in this pathway
MOREAUX MULTIPLE MYELOMA BY TACI UP 412 249 All SZGR 2.0 genes in this pathway
VERHAAK AML WITH NPM1 MUTATED DN 246 180 All SZGR 2.0 genes in this pathway
HOEGERKORP CD44 TARGETS TEMPORAL DN 25 16 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS MATURE CELL 293 160 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237 837 All SZGR 2.0 genes in this pathway
LEE AGING CEREBELLUM DN 86 66 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR UP 180 125 All SZGR 2.0 genes in this pathway
XU GH1 EXOGENOUS TARGETS UP 85 50 All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY UP 487 303 All SZGR 2.0 genes in this pathway
XU GH1 AUTOCRINE TARGETS UP 268 157 All SZGR 2.0 genes in this pathway
HOWLIN CITED1 TARGETS 1 UP 35 25 All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3 491 310 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP 673 430 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN 593 372 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN 591 366 All SZGR 2.0 genes in this pathway
GRADE COLON AND RECTAL CANCER DN 101 65 All SZGR 2.0 genes in this pathway
MALONEY RESPONSE TO 17AAG DN 79 45 All SZGR 2.0 genes in this pathway
MOOTHA MITOCHONDRIA 447 277 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS DN 435 289 All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 8 26 17 All SZGR 2.0 genes in this pathway
MIKKELSEN IPS ICP WITH H3K4ME3 AND H327ME3 126 83 All SZGR 2.0 genes in this pathway
HAHTOLA CTCL CUTANEOUS 26 19 All SZGR 2.0 genes in this pathway
DANG REGULATED BY MYC DN 253 192 All SZGR 2.0 genes in this pathway
RAGHAVACHARI PLATELET SPECIFIC GENES 70 46 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS UP 504 321 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A 898 516 All SZGR 2.0 genes in this pathway
ISSAEVA MLL2 TARGETS 62 35 All SZGR 2.0 genes in this pathway
VANDESLUIS COMMD1 TARGETS GROUP 3 UP 89 50 All SZGR 2.0 genes in this pathway
SERVITJA ISLET HNF1A TARGETS UP 163 111 All SZGR 2.0 genes in this pathway
PLASARI NFIC TARGETS BASAL UP 27 17 All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE VIA P38 PARTIAL 160 106 All SZGR 2.0 genes in this pathway
FOSTER KDM1A TARGETS UP 266 142 All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP 489 314 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-153 459 465 m8 hsa-miR-153 UUGCAUAGUCACAAAAGUGA
miR-324-3p 131 137 1A hsa-miR-324-3p CCACUGCCCCAGGUGCUGCUGG
miR-495 417 423 1A hsa-miR-495brain AAACAAACAUGGUGCACUUCUUU
miR-539 89 96 1A,m8 hsa-miR-539 GGAGAAAUUAUCCUUGGUGUGU
miR-7 120 127 1A,m8 hsa-miR-7SZ UGGAAGACUAGUGAUUUUGUUG