Gene Page:SNTB2

Summary?
GeneID 6645
Symbol SNTB2
Synonyms D16S2531E|EST25263|SNT2B2|SNT3|SNTL
Description syntrophin beta 2
Reference MIM:600027|HGNC:HGNC:11169|Ensembl:ENSG00000168807|HPRD:02491|Vega:OTTHUMG00000137567
Gene type protein-coding
Map location 16q22.1
Pascal p-value 0.002
Sherlock p-value 0.71
Fetal beta -0.369
DMG 1 (# studies)
eGene Cerebellum
Support G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS
CompositeSet

Gene in Data Sources
基因集名称 Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:vanEijk_2014 Genome-wide DNA methylation analysis This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). 3
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.2389

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg04779191 16 69166964 SNTB2 0.002 4.041 DMG:vanEijk_2014
cg12265604 16 69139568 SNTB2 0.001 3.903 DMG:vanEijk_2014
cg22067472 16 69458746 SNTB2 9.347E-4 3.055 DMG:vanEijk_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003779 actin binding IEA -
GO:0005509 calcium ion binding IEA -
GO:0005516 calmodulin binding IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0045202 synapse IEA neuron, Synap, Neurotransmitter, Glial (GO term level: 2) -
GO:0005856 cytoskeleton IEA -
去:0005874 microtubule IEA -
: 0005624 membrane fraction TAS 8576247
GO:0005737 cytoplasm IEA -
GO:0016020 membrane IEA -
GO:0016010 dystrophin-associated glycoprotein complex TAS 8576247
GO:0030054 cell junction IEA -
GO:0031410 cytoplasmic vesicle IEA -

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
ABCA1 ABC-1 | ABC1 | CERP | FLJ14958 | HDLDT1 | MGC164864 | MGC165011 | TGD ATP-binding cassette, sub-family A (ABC1), member 1 - HPRD,BioGRID 12054535
DGKZ DAGK5 | DAGK6 | DGK-ZETA | hDGKzeta diacylglycerol kinase, zeta 104kDa - HPRD,BioGRID 11352924
DMD BMD | CMD3B | DXS142 | DXS164 | DXS206 | DXS230 | DXS239 | DXS268 | DXS269 | DXS270 | DXS272 dystrophin Protein-peptide BioGRID 8576247
DTNA D18S892E | DRP3 | DTN | FLJ96209 | LVNC1 dystrobrevin, alpha - HPRD 12206805
ERBB4 HER4 | MGC138404 | p180erbB4 v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) - HPRD,BioGRID 10725395
ERBB4 HER4 | MGC138404 | p180erbB4 v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) ErbB-4 interacts with beta 2-syntropin. BIND 10725395
KCNJ12 FLJ14167 | IRK2 | KCNJN1 | Kir2.2 | Kir2.2v | hIRK | hIRK1 | hkir2.2x | kcnj12x potassium inwardly-rectifying channel, subfamily J, member 12 - HPRD,BioGRID 15024025
MAST1 KIAA0973 | SAST | SAST170 microtubule associated serine/threonine kinase 1 - HPRD,BioGRID 10404183
MAST2 FLJ39200 | KIAA0807 | MAST205 | MTSSK | RP4-533D7.1 microtubule associated serine/threonine kinase 2 - HPRD,BioGRID 10404183
PTPRN FLJ16131 | IA-2 | IA-2/PTP | IA2 | ICA512 | R-PTP-N protein tyrosine phosphatase, receptor type, N - HPRD,BioGRID 11483505
SCN5A CDCD2 | CMD1E | CMPD2 | HB1 | HB2 | HBBD | HH1 | ICCD | IVF | LQT3 | Nav1.5 | PFHB1 | SSS1 sodium channel, voltage-gated, type V, alpha subunit Affinity Capture-Western BioGRID 9412493
UTRN DMDL | DRP | DRP1 | FLJ23678 utrophin - HPRD,BioGRID 8576247|10995443


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN 391 222 All SZGR 2.0 genes in this pathway
TURASHVILI BREAST LOBULAR CARCINOMA VS DUCTAL NORMAL DN 91 53 All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER UP 404 246 All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS DN 459 276 All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL DN 226 132 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN 537 339 All SZGR 2.0 genes in this pathway
PROVENZANI METASTASIS UP 194 112 All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN 485 334 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 5 6WK DN 137 97 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 6 7WK UP 197 135 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL TGFB1 TARGETS UP 169 127 All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE UP 134 93 All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN 848 527 All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION UP 195 138 All SZGR 2.0 genes in this pathway
HADDAD B LYMPHOCYTE PROGENITOR 293 193 All SZGR 2.0 genes in this pathway
VERNELL RETINOBLASTOMA PATHWAY UP 70 47 All SZGR 2.0 genes in this pathway
SARTIPY BLUNTED BY INSULIN RESISTANCE UP 19 17 All SZGR 2.0 genes in this pathway
瑞士POSTRADIATION肿瘤逃逸 393 244 All SZGR 2.0 genes in this pathway
KONDO EZH2 TARGETS 245 148 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN 543 317 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN 593 372 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN 591 366 All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN 353 226 All SZGR 2.0 genes in this pathway
AMBROSINI FLAVOPIRIDOL TREATMENT TP53 109 63 All SZGR 2.0 genes in this pathway
STAMBOLSKY RESPONSE TO VITAMIN D3 UP 84 48 All SZGR 2.0 genes in this pathway
国外RB1 TARGETS CONFLUENT 567 365 All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR DN 505 328 All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS NOT VIA AKT1 DN 88 61 All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS VIA AKT1 DN 82 51 All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN 918 550 All SZGR 2.0 genes in this pathway
DELACROIX RARG BOUND MEF 367 231 All SZGR 2.0 genes in this pathway
DELACROIX RAR TARGETS DN 24 16 All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES 462 273 All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 227 149 All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP 489 314 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-124/506 853 859 m8 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brain UAAGGCACGCGGUGAAUGCC
hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brain UAAGGCACGCGGUGAAUGCC
miR-135 825 831 m8 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUG
miR-138 7271 7277 1A hsa-miR-138brain AGCUGGUGUUGUGAAUC
miR-149 777 783 m8 hsa-miR-149brain UCUGGCUCCGUGUCUUCACUCC
miR-15/16/195/424/497 4295 4302 1A,m8 hsa-miR-15abrain UAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brain UAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrain UAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZ UAGCAGCACAGAAAUAUUGGC
hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497 CAGCAGCACACUGUGGUUUGU
miR-17-5p/20/93.mr/106/519.d 3474 3480 m8 hsa-miR-17-5p CAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrain UAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106a AAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZ UAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZ CAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUGU
mir - 218 64 71 1A,m8 hsa-miR-218brain UUGUGCUUGAUCUAACCAUGU
miR-331 780 787 1A,m8 hsa-miR-331brain GCCCCUGGGCCUAUCCUAGAA
miR-410 8062 8068 1A hsa-miR-410 AAUAUAACACAGAUGGCCUGU
miR-503 4296 4302 1A hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG