Gene Page:SOX10

概括?
基因 6663
Symbol SOX10
Synonyms DOM|PCWH|WS2E|WS4|WS4C
Description SRY-box 10
Reference MIM:602229|HGNC:HGNC:11190|Ensembl:ENSG00000100146|HPRD:03752|Vega:OTTHUMG00000149913
Gene type protein-coding
Map location 22q13.1
Pascal p-value 0.446
Sherlock p-value 0.348
DEG p-value DEG：Zhao_2015:p=2.10e-04:q=0.0860
Fetal beta -1.154
DMG 1 (# studies)
eGene 元

Gene in Data Sources
Gene set name Method of gene set Description Info
DEG：Zhao_2015 RNA Sequencing analysis Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder.
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association A combined odds ratio method (Sun et al. 2008), association studies 2 Link to SZGene
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg06614002 22 38380439 SOX10 5.104E-4 -0.409 0.047 DMG:Wockner_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0003677 DNA binding IEA -
GO:0003682 chromatin binding IEA -
GO:0003705 RNA polymerase II transcription factor activity, enhancer binding IEA -
GO:0003713 transcription coactivator activity TAS 9722528
GO:0042802 identical protein binding 新闻学会 11029584
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0048709 oligodendrocyte differentiation IEA neuron, axon, oligodendrocyte, Glial (GO term level: 9) -
GO:0048484 enteric nervous system development IEA neuron (GO term level: 7) -
GO:0001701 in utero embryonic development IEA -
GO:0006350 transcription IEA -
GO:0009653 anatomical structure morphogenesis TAS 9425902
GO:0048469 cell maturation IEA -
GO:0007605 声音的感官感知 IEA -
GO:0007422 peripheral nervous system development IEA -
GO:0030154 cell differentiation IEA -
去：0030318 melanocyte differentiation IEA -
GO:0045944 positive regulation of transcription from RNA polymerase II promoter IEA -
GO:0048589 developmental growth IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -
GO:0005737 cytoplasm IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
LEE NEURAL CREST STEM CELL UP 146 99 All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA DN 291 176 All SZGR 2.0 genes in this pathway
LIU CDX2 TARGETS UP 36 22 All SZGR 2.0 genes in this pathway
ODONNELL METASTASIS UP 82 58 All SZGR 2.0 genes in this pathway
COLIN PILOCYTIC ASTROCYTOMA VS GLIOBLASTOMA UP 35 32 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH ES CORE NINE CORRELATED 100 68 All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS DN 357 212 All SZGR 2.0 genes in this pathway
ASTON MAJOR DEPRESSIVE DISORDER DN 160 110 All SZGR 2.0 genes in this pathway
MODY HIPPOCAMPUS POSTNATAL 63 50 All SZGR 2.0 genes in this pathway
MCCLUNG COCAINE REWARD 5D 79 62 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 6HR UP 71 48 All SZGR 2.0 genes in this pathway
LEIN OLIGODENDROCYTE MARKERS 74 53 All SZGR 2.0 genes in this pathway
MCGOWAN RSP6 TARGETS UP 18 12 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BONE DN 315 197 All SZGR 2.0 genes in this pathway
乳腺癌萧述三腔的DN 564 326 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER ERBB2 DN 5 5 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL UP 648 398 All SZGR 2.0 genes in this pathway
ZHANG BREAST CANCER PROGENITORS DN 145 93 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER ESR1 DN 240 153 All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A12 317 177 All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL 177 132 All SZGR 2.0 genes in this pathway
CERIBELLI PROMOTERS INACTIVE AND BOUND BY NFY 44 20 All SZGR 2.0 genes in this pathway
LIM MAMMARY LUMINAL MATURE DN 99 74 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-155 1143 1149 1A hsa-miR-155 UUAAUGCUAAUCGUGAUAGGGG