Gene Page:SP1

Summary?
GeneID 6667
Symbol SP1
Synonyms -
Description Sp1 transcription factor
Reference MIM:189906|HGNC:HGNC:11205|Ensembl:ENSG00000185591|HPRD:01796|Vega:OTTHUMG00000170047
Gene type protein-coding
Map location 12q13.1
Pascal p-value 0.043
Sherlock p-value 0.392
Fetal beta 0.532
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias Click to show details
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0366

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs16829545 chr2 151977407 SP1 6667 0.05 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003690 double-stranded DNA binding 国际能源机构 -
GO:0003700 transcription factor activity IDA 12560508
GO:0003702 RNA polymerase II transcription factor activity NAS 3139301
GO:0008270 zinc ion binding 国际能源机构 -
GO:0008022 protein C-terminus binding IPI 10816420
GO:0016563 transcription activator activity IDA 14580349
GO:0042803 protein homodimerization activity IDA 10393239
GO:0046872 metal ion binding 国际能源机构 -
GO:0043565 sequence-specific DNA binding IDA 12169688
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006350 transcription 国际能源机构 -
GO:0045893 positive regulation of transcription, DNA-dependent IDA 14580349
GO:0045817 positive regulation of transcription from RNA polymerase II promoter, global IDA 12169688
GO:0044419 interspecies interaction between organisms 国际能源机构 -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005622 intracellular 国际能源机构 -
GO:0005634 nucleus IC 3139301
GO:0005730 nucleolus IDA 18029348
GO:0005737 cytoplasm IDA 18029348

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
AATF CHE-1 | CHE1 | DED apoptosis antagonizing transcription factor - HPRD,BioGRID 12847090
AHR - aryl hydrocarbon receptor - HPRD,BioGRID 10471301|12612060
AR AIS | DHTR | HUMARA | KD | NR3C4 | SBMA | SMAX1 | TFM androgen receptor Affinity Capture-Western BioGRID 15661808
ARNT HIF-1beta | HIF1B | HIF1BETA | TANGO | bHLHe2 aryl hydrocarbon receptor nuclear translocator Reconstituted Complex BioGRID 10471301
ATF7IP FLJ10139 | FLJ10688 | MCAF | p621 activating transcription factor 7 interacting protein MCAF1 interacts with Sp1. BIND 15691849
ATF7IP2 FLJ12668 | MCAF2 activating transcription factor 7 interacting protein 2 MCAF2 interacts with Sp1. BIND 15691849
BCL6 BCL5 | BCL6A | LAZ3 | ZBTB27 | ZNF51 B-cell CLL/lymphoma 6 - HPRD 12004059
BRCA1 BRCAI | BRCC1 | IRIS | PSCP | RNF53 breast cancer 1, early onset - HPRD 10720440
BRCA1 BRCAI | BRCC1 | IRIS | PSCP | RNF53 breast cancer 1, early onset BRCA1 interacts with Sp1. BIND 12706836
BRCA1 BRCAI | BRCC1 | IRIS | PSCP | RNF53 breast cancer 1, early onset Affinity Capture-Western BioGRID 12706836
C14orf106 FLJ11186 | HSA242977 | KIAA1903 | MIS18BP1 chromosome 14 open reading frame 106 - HPRD 10976766
CD2 SRBC | T11 CD2 molecule - HPRD 7933095
CD209 CDSIGN | CLEC4L | DC-SIGN | DC-SIGN1 | MGC129965 CD209 molecule Sp1 interacts with the CD209 promoter. BIND 15838506
CDC25C CDC25 cell division cycle 25 homolog C (S. pombe) Sp1 interacts with the cdc25c promoter. BIND 15574328
CDKN1A CAP20 | CDKN1 | CIP1 | MDA-6 | P21 | SDI1 | WAF1 | p21CIP1 cyclin-dependent kinase inhibitor 1A (p21, Cip1) SP1interacts with the CDKN1A (p21) promoter. BIND 15674334
CDKN1A CAP20 | CDKN1 | CIP1 | MDA-6 | P21 | SDI1 | WAF1 | p21CIP1 cyclin-dependent kinase inhibitor 1A (p21, Cip1) Sp1 interacts with CDKN1A promoter. BIND 15780936
CEBPB C/EBP-beta | CRP2 | IL6DBP | LAP | MGC32080 | NF-IL6 | TCF5 CCAAT/enhancer binding protein (C/EBP), beta - HPRD,BioGRID 12847250
CLCN1 CLC1 | MGC138361 | MGC142055 chloride channel 1, skeletal muscle p-CLCN1 interacts with Sp1. BIND 14657503
DMPK DM | DM1 | DM1PK | DMK | MDPK | MT-PK dystrophia myotonica-protein kinase Mutant DMPK mRNA interacts with Sp1. BIND 14657503
E2F1 E2F-1 | RBAP1 | RBBP3 | RBP3 E2F transcription factor 1 - HPRD,BioGRID 10547281
E2F2 E2F-2 E2F transcription factor 2 - HPRD 8657141|8657142
|9694791
E2F3 DKFZp686C18211 | E2F-3 | KIAA0075 | MGC104598 E2F transcription factor 3 - HPRD 8657141
EGR1 AT225 | G0S30 | KROX-24 | NGFI-A | TIS8 | ZIF-268 | ZNF225 early growth response 1 Egr1 interacts with Sp1.This interaction was modelled on a demonstrated interaction between human Egr1 and mouse Sp1. BIND 12569082
ELF1 - E74-like因子1 (ets域转录因子) - HPRD,BioGRID 10976766
GABPA E4TF1-60 | E4TF1A | NFT2 | NRF2 | NRF2A GA binding protein transcription factor, alpha subunit 60kDa - HPRD,BioGRID 11237613
GATA1 ERYF1 | GF-1 | GF1 | NFE1 GATA binding protein 1 (globin transcription factor 1) Reconstituted Complex BioGRID 12239153
GRIN1 NMDA1 | NMDAR1 | NR1 glutamate receptor, ionotropic, N-methyl D-aspartate 1 - HPRD 14970236
HCFC1 CFF | HCF-1 | HCF1 | HFC1 | MGC70925 | VCAF host cell factor C1 (VP16-accessory protein) - HPRD,BioGRID 10976766|12670868
HDAC1 DKFZp686H12203 | GON-10 | HD1 | RPD3 | RPD3L1 histone deacetylase 1 Affinity Capture-Western BioGRID 11896613|12091390
|12176973|12847090
HDAC1 DKFZp686H12203 | GON-10 | HD1 | RPD3 | RPD3L1 histone deacetylase 1 - HPRD 11896613|11909966
HDAC2 RPD3 | YAF1 histone deacetylase 2 - HPRD,BioGRID 12151407
HIF1A HIF-1alpha | HIF1 | HIF1-ALPHA | MOP1 | PASD8 hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) Sp1 interacts with HIF-1alpha. BIND 15780936
HMGA1 HMG-R | HMGA1A | HMGIY | MGC12816 | MGC4242 | MGC4854 high mobility group AT-hook 1 - HPRD,BioGRID 12665574
HSPA8 HSC54 | HSC70 | HSC71 | HSP71 | HSP73 | HSPA10 | LAP1 | MGC131511 | MGC29929 | NIP71 heat shock 70kDa protein 8 - HPRD 10976766
HTT HD | IT15 huntingtin - HPRD,BioGRID 11839795
HTT HD | IT15 huntingtin Huntingtin interacts with Sp1. This interaction was modelled on a demonstrated interaction between Huntingtin from human and Sp1 from rat. BIND 11839795
JUN AP-1 | AP1 | c-Jun jun oncogene - HPRD,BioGRID 10506225
KLF10 EGRA | TIEG | TIEG1 Kruppel-like factor 10 - HPRD,BioGRID 10976766
KLF4 EZF | GKLF Kruppel-like factor 4 (gut) - HPRD,BioGRID 9651398|12034813
KLF6 BCD1 | COPEB | CPBP | DKFZp686N0199 | GBF | PAC1 | ST12 | ZF9 Kruppel-like factor 6 - HPRD,BioGRID 12433697
LDB1 CLIM2 | NLI LIM domain binding 1 Reconstituted Complex BioGRID 12239153
LMO2 RBTN2 | RBTNL1 | RHOM2 | TTG2 LIM domain only 2 (rhombotin-like 1) Reconstituted Complex BioGRID 12239153
MDM2 HDMX | MGC71221 | hdm2 Mdm2 p53 binding protein homolog (mouse) SP1interacts with the MDM2 intronic promoter. BIND 15550242
MEF2C - myocyte enhancer factor 2C - HPRD,BioGRID 9748305
MEF2D DKFZp686I1536 myocyte enhancer factor 2D - HPRD,BioGRID 12213324
MIER1 DKFZp781G0451 | ER1 | KIAA1610 | MGC131940 | MGC150640 | MGC150641 | MI-ER1 | RP5-944N15.1 | hMI-ER1 mesoderm induction early response 1 homolog (Xenopus laevis) - HPRD 15117948
MSX1 HOX7 | HYD1 msh homeobox 1 - HPRD,BioGRID 10215616
MYC bHLHe39 | c-Myc v-myc myelocytomatosis viral oncogene homolog (avian) Myc interacts with Sp1. This interaction was modeled on a demonstrated interaction between mouse Myc and human Sp-1. BIND 11274368
MYC bHLHe39 | c-Myc v-myc myelocytomatosis viral oncogene homolog (avian) Sp1 interacts with Myc. BIND 15780936
MYC bHLHe39 | c-Myc v-myc myelocytomatosis viral oncogene homolog (avian) - HPRD,BioGRID 11274368
MYOD1 MYF3 | MYOD | PUM | bHLHc1 myogenic differentiation 1 - HPRD,BioGRID 10082523
MYOG MYF4 | MYOGENIN | bHLHc3 myogenin (myogenic factor 4) - HPRD,BioGRID 10082523
NCL C23 | FLJ45706 nucleolin Affinity Capture-Western BioGRID 14623863
NFKB1 DKFZp686C01211 | EBP-1 | KBF1 | MGC54151 | NF-kappa-B | NFKB-p105 | NFKB-p50 | p105 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 Reconstituted Complex BioGRID 7933095
NFKB2 LYT-10 | LYT10 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100) Reconstituted Complex BioGRID 7933095
NOS3 ECNOS | eNOS nitric oxide synthase 3 (endothelial cell) - HPRD 7541039
NR2F1 COUP-TFI | EAR-3 | EAR3 | ERBAL3 | NR2F2 | SVP44 | TCFCOUP1 | TFCOUP1 nuclear receptor subfamily 2, group F, member 1 - HPRD,BioGRID 9388268
NR5A1 AD4BP | ELP | FTZ1 | FTZF1 | SF-1 | SF1 nuclear receptor subfamily 5, group A, member 1 - HPRD,BioGRID 10919277
PGR NR3C3 | PR progesterone receptor Sp1 interacts with the PgRA promoter. BIND 15019994
PGR NR3C3 | PR progesterone receptor Sp1 interacts with the PgRB promoter. BIND 15019994
PML MYL | PP8675 | RNF71 | TRIM19 promyelocytic leukemia - HPRD,BioGRID 9819401
POGZ KIAA0461 | MGC71543 | SUHW5 | ZNF280E | ZNF635 | ZNF635m pogo transposable element with ZNF domain - HPRD,BioGRID 10976766
POU2F1 OCT1 | OTF1 POU class 2 homeobox 1 - HPRD,BioGRID 8668525
PPP1R13L IASPP | NKIP1 | RAI protein phosphatase 1, regulatory (inhibitor) subunit 13 like - HPRD,BioGRID 12134007
PSIP1 DFS70 | LEDGF | MGC74712 | PAIP | PSIP2 | p52 | p75 PC4 and SFRS1 interacting protein 1 Reconstituted Complex BioGRID 9885563
PSMC5 S8 | SUG1 | TBP10 | TRIP1 | p45 | p45/SUG proteasome (prosome, macropain) 26S subunit, ATPase, 5 - HPRD,BioGRID 10816420
PURA PUR-ALPHA | PUR1 | PURALPHA purine-rich element binding protein A - HPRD,BioGRID 10457364
RARA NR1B1 | RAR retinoic acid receptor, alpha Reconstituted Complex BioGRID 10361124
RB1 OSRC | RB | p105-Rb | pRb | pp110 retinoblastoma 1 - HPRD 7732011
RB1 OSRC | RB | p105-Rb | pRb | pp110 retinoblastoma 1 Affinity Capture-Western BioGRID 11896613
RBBP4 NURF55 | RBAP48 retinoblastoma binding protein 4 - HPRD,BioGRID 12091390|12943729
RECQL4 RECQ4 RecQ protein-like 4 SP1interacts with the RECQL4 (RECQ4) promoter. BIND 15674334
REL C-Rel v-rel reticuloendotheliosis viral oncogene homolog (avian) - HPRD,BioGRID 7933095
RELA MGC131774 | NFKB3 | p65 v-rel reticuloendotheliosis viral oncogene homolog A (avian) - HPRD 7933095|12055073
RELA MGC131774 | NFKB3 | p65 v-rel reticuloendotheliosis viral oncogene homolog A (avian) Affinity Capture-Western
Reconstituted Complex		 BioGRID 7933095|12055073
RNASEN DROSHA | ETOHI2 | HSA242976 | RANSE3L | RN3 | RNASE3L ribonuclease type III, nuclear - HPRD 10976766
RNF4 RES4-26 | SNURF ring finger protein 4 Affinity Capture-Western BioGRID 10617653
RXRA FLJ00280 | FLJ00318 | FLJ16020 | FLJ16733 | MGC102720 | NR2B1 retinoid X receptor, alpha Reconstituted Complex BioGRID 10361124
SF3A1 PRP21 | PRPF21 | SAP114 | SF3A120 splicing factor 3a, subunit 1, 120kDa - HPRD 10976766
SHC1 FLJ26504 | SHC | SHCA SHC (Src homology 2 domain containing) transforming protein 1 - HPRD 7933095
SKIV2L2 Dob1 | KIAA0052 | MGC142069 | Mtr4 | fSAP118 superkiller viralicidic activity 2-like 2 (S. cerevisiae) - HPRD 14676314
SMAD2 JV18 | JV18-1 | MADH2 | MADR2 | MGC22139 | MGC34440 | hMAD-2 | hSMAD2 SMAD family member 2 - HPRD,BioGRID 11114293
SMAD3 DKFZp586N0721 | DKFZp686J10186 | HSPC193 | HsT17436 | JV15-2 | MADH3 | MGC60396 SMAD family member 3 Affinity Capture-Western BioGRID 11114293|11432852
SMAD4 DPC4似|吉格| MADH4 SMAD family member 4 - HPRD 11432852
SMARCA4 BAF190 | BRG1 | FLJ39786 | SNF2 | SNF2-BETA | SNF2L4 | SNF2LB | SWI2 | hSNF2b SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 Reconstituted Complex BioGRID 11018012
SMARCC1 BAF155 | CRACC1 | Rsc8 | SRG3 | SWI3 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 Reconstituted Complex BioGRID 11018012
SMARCC2 BAF170 | CRACC2 | Rsc8 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 Reconstituted Complex BioGRID 11018012
SP3 DKFZp686O1631 | SPR-2 Sp3 transcription factor - HPRD 9329821
SP4 HF1B | MGC130008 | MGC130009 | SPR-1 Sp4 transcription factor - HPRD,BioGRID 7559627
SREBF1 SREBP-1c | SREBP1 | bHLHd1 sterol regulatory element binding transcription factor 1 - HPRD,BioGRID 10224053
SREBF2 SREBP2 | bHLHd2 sterol regulatory element binding transcription factor 2 - HPRD,BioGRID 10976766
SRF MCM1 serum response factor (c-fos serum response element-binding transcription factor) Reconstituted Complex BioGRID 10082523
SUB1 MGC102747 | P15 | PC4 | p14 SUB1 homolog (S. cerevisiae) Reconstituted Complex BioGRID 9885563
TAF4 FLJ41943 | TAF2C | TAF2C1 | TAF4A | TAFII130 | TAFII135 TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa - HPRD,BioGRID 9742090
TAL1 SCL | TCL5 | bHLHa17 | tal-1 T-cell acute lymphocytic leukemia 1 - HPRD,BioGRID 12239153
TNFSF10 APO2L | Apo-2L | CD253 | TL2 | TRAIL tumor necrosis factor (ligand) superfamily, member 10 SP1interacts with the TNFSF10 promoter. BIND 15619633
TP53 FLJ92943 | LFS1 | TRP53 | p53 tumor protein p53 p53 interacts with Sp1. BIND 15574328
TP53 FLJ92943 | LFS1 | TRP53 | p53 tumor protein p53 p53 interacts with Sp1. BIND 9492043
TP53 FLJ92943 | LFS1 | TRP53 | p53 tumor protein p53 TP53 (p53) interacts with Sp1. BIND 9685344
TP53 FLJ92943 | LFS1 | TRP53 | p53 tumor protein p53 TP53 (p53) interacts with SP1. BIND 15674334
YY1 DELTA | INO80S | NF-E1 | UCRBP | YIN-YANG-1 YY1 transcription factor Affinity Capture-Western BioGRID 10224053
YY1 DELTA | INO80S | NF-E1 | UCRBP | YIN-YANG-1 YY1 transcription factor YY1 interacts with Sp1. BIND 8327494
ZBTB16 PLZF | ZNF145 zinc finger and BTB domain containing 16 - HPRD 12004059
ZBTB7A DKFZp547O146 | FBI-1 | FBI1 | LRF | MGC99631 | ZBTB7 | ZNF857A | pokemon zinc finger and BTB domain containing 7A - HPRD 12004059


Section V. Pathway annotation

Pathway name Pathway size 2.0 # SZGR pathwa基因y Info
KEGG TGF BETA SIGNALING PATHWAY 86 64 All SZGR 2.0 genes in this pathway
KEGG HUNTINGTONS DISEASE 185 109 All SZGR 2.0 genes in this pathway
BIOCARTA AGR PATHWAY 36 31 All SZGR 2.0 genes in this pathway
BIOCARTA CALCINEURIN PATHWAY 21 17 All SZGR 2.0 genes in this pathway
BIOCARTA HCMV PATHWAY 17 16 All SZGR 2.0 genes in this pathway
BIOCARTA KERATINOCYTE PATHWAY 46 38 All SZGR 2.0 genes in this pathway
BIOCARTA MAPK PATHWAY 87 68 All SZGR 2.0 genes in this pathway
BIOCARTA PPARA PATHWAY 58 43 All SZGR 2.0 genes in this pathway
PID SMAD2 3NUCLEAR PATHWAY 82 63 All SZGR 2.0 genes in this pathway
PID P73PATHWAY 79 59 All SZGR 2.0 genes in this pathway
PID IL4 2PATHWAY 65 43 All SZGR 2.0 genes in this pathway
PID E2F PATHWAY 74 48 All SZGR 2.0 genes in this pathway
PID HIF2PATHWAY 34 29 All SZGR 2.0 genes in this pathway
PID FRA PATHWAY 37 28 All SZGR 2.0 genes in this pathway
PID TELOMERASE PATHWAY 68 48 All SZGR 2.0 genes in this pathway
PID HNF3B PATHWAY 45 37 All SZGR 2.0 genes in this pathway
PID P53 DOWNSTREAM PATHWAY 137 94 All SZGR 2.0 genes in this pathway
PID AP1 PATHWAY 70 60 All SZGR 2.0 genes in this pathway
PID FOXM1 PATHWAY 40 30 All SZGR 2.0 genes in this pathway
PID CMYB PATHWAY 84 61 All SZGR 2.0 genes in this pathway
PID IL2 STAT5 PATHWAY 30 23 All SZGR 2.0 genes in this pathway
PID MYC REPRESS PATHWAY 63 52 All SZGR 2.0 genes in this pathway
PID HIF1 TFPATHWAY 66 52 All SZGR 2.0 genes in this pathway
PID TAP63 PATHWAY 54 40 All SZGR 2.0 genes in this pathway
PID HNF3A PATHWAY 44 29 All SZGR 2.0 genes in this pathway
REACTOME SMAD2 SMAD3 SMAD4 HETEROTRIMER REGULATES TRANSCRIPTION 27 17 All SZGR 2.0 genes in this pathway
REACTOME TRANSCRIPTIONAL ACTIVITY OF SMAD2 SMAD3 SMAD4 HETEROTRIMER 38 26 All SZGR 2.0 genes in this pathway
REACTOME GENERIC TRANSCRIPTION PATHWAY 352 181 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY TGF BETA RECEPTOR COMPLEX 63 42 All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE UP 423 283 All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED UP 78 48 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN 805 505 All SZGR 2.0 genes in this pathway
TURJANSKI MAPK1 AND MAPK2 TARGETS 12 10 All SZGR 2.0 genes in this pathway
PUJANA BREAST CANCER LIT INT NETWORK 101 73 All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS 957 597 All SZGR 2.0 genes in this pathway
COLLIS PRKDC SUBSTRATES 20 15 All SZGR 2.0 genes in this pathway
SASAKI ADULT T CELL LEUKEMIA 176 122 All SZGR 2.0 genes in this pathway
GUO HEX TARGETS UP 81 54 All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP 314 201 All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS DN 120 81 All SZGR 2.0 genes in this pathway
MUELLER PLURINET 299 189 All SZGR 2.0 genes in this pathway
LEE DIFFERENTIATING T LYMPHOCYTE 200 115 All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE S 162 86 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS DN 553 343 All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B 517 302 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-124.1 524 530 m8 hsa-miR-124a UUAAGGCACGCGGUGAAUGCCA
miR-124/506 524 530 1A hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brain UAAGGCACGCGGUGAAUGCC
hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brain UAAGGCACGCGGUGAAUGCC
miR-125/351 3141 3147 1A hsa-miR-125bbrain UCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrain UCCCUGAGACCCUUUAACCUGUG
miR-128 4516 4522 m8 hsa-miR-128a UCACAGUGAACCGGUCUCUUUU
hsa-miR-128b UCACAGUGAACCGGUCUCUUUC
hsa-miR-128a UCACAGUGAACCGGUCUCUUUU
hsa-miR-128b UCACAGUGAACCGGUCUCUUUC
miR-135 344 350 m8 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUG
miR-149 3809 3815 m8 hsa-miR-149brain UCUGGCUCCGUGUCUUCACUCC
miR-193 3811 3817 1A hsa-miR-193a AACUGGCCUACAAAGUCCCAG
hsa-miR-193b AACUGGCCCUCAAAGUCCCGCUUU
miR-214 3918 3924 1A hsa-miR-214brain ACAGCAGGCACAGACAGGCAG
miR-218 1405 1411 m8 hsa-miR-218brain UUGUGCUUGAUCUAACCAUGU
miR-22 4733 4739 m8 hsa-miR-22brain AAGCUGCCAGUUGAAGAACUGU
miR-24 542 548 m8 hsa-miR-24SZ UGGCUCAGUUCAGCAGGAACAG
miR-25/32/92/363/367 1779 1785 1A hsa-miR-25brain CAUUGCACUUGUCUCGGUCUGA
hsa-miR-32 UAUUGCACAUUACUAAGUUGC
hsa-miR-92 UAUUGCACUUGUCCCGGCCUG
hsa-miR-367 AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZ UAUUGCACUCGUCCCGGCCUC
miR-27 1663 1669 m8 hsa-miR-27abrain UUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrain UUCACAGUGGCUAAGUUCUGC
miR-29 3168 3174 1A hsa-miR-29aSZ UAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZ UAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZ UAGCACCAUUUGAAAUCGGU
hsa-miR-29aSZ UAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZ UAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZ UAGCACCAUUUGAAAUCGGU
miR-326 17 23 1A hsa-miR-326 CCUCUGGGCCCUUCCUCCAG
miR-33 1580 1586 1A hsa-miR-33 GUGCAUUGUAGUUGCAUUG
hsa-miR-33b GUGCAUUGCUGUUGCAUUGCA
miR-330 4035 4041 1A hsa-miR-330brain GCAAAGCACACGGCCUGCAGAGA
miR-335 4579 4586 1A,m8 hsa-miR-335brain UCAAGAGCAAUAACGAAAAAUGU
miR-361 3921 3927 1A hsa-miR-361brain UUAUCAGAAUCUCCAGGGGUAC
hsa-miR-361brain UUAUCAGAAUCUCCAGGGGUAC
miR-369-3p 412 418 1A hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
miR-374 412 418 m8 hsa-miR-374 UUAUAAUACAACCUGAUAAGUG
miR-375 1434 1440 1A hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA
miR-376 3413 3419 1A hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
hsa-miR-376b AUCAUAGAGGAAAAUCCAUGUU
miR-378 2297 2303 1A hsa-miR-378 CUCCUGACUCCAGGUCCUGUGU
hsa-miR-378 CUCCUGACUCCAGGUCCUGUGU
miR-381 3354 3360 1A hsa - mir - 381 UAUACAAGGGCAAGCUCUCUGU
miR-410 414 420 1A hsa-miR-410 AAUAUAACACAGAUGGCCUGU
miR-485-3p 5008 5014 m8 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU
miR-493-5p 5135 5141 1A hsa-miR-493-5p UUGUACAUGGUAGGCUUUCAUU
miR-495 4906 4912 m8 hsa-miR-495brain AAACAAACAUGGUGCACUUCUUU
miR-7 1152 1159 1A,m8 hsa-miR-7SZ UGGAAGACUAGUGAUUUUGUUG