Gene Page:SP3

Summary?
GeneID 6670
Symbol SP3
Synonyms SPR2
Description Sp3 transcription factor
Reference MIM:601804|HGNC:HGNC:11208|Ensembl:ENSG00000172845|HPRD: 03483|Vega:OTTHUMG00000132333
Gene type protein-coding
Map location 2q31
Pascal p-value 0.238
Sherlock p-value 0.494
Fetal beta 1.162

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0333

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

前10名及tively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
RAB11FIP4 0.87 0.89
PCNXL2 0.84 0.88
FBXO10 0.84 0.84
RHOBTB2 0.83 0.89
OSBP2 0.82 0.85
C4orf50 0.82 0.85
GABBR2 0.82 0.83
CAMK2B 0.82 0.84
CNNM1 0.82 0.83
FBXO41 0.82 0.87
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
GNG11 -0.44 -0.50
AF347015.21 -0.43 -0.41
C1orf54 -0.43 -0.50
AL139819.3 -0.43 -0.44
SAT1 -0.43 -0.49
C1orf61 -0.42 -0.49
AP002478.3 -0.41 -0.45
S100A13 -0.40 -0.39
ACAA2 -0.40 -0.41
MYL12A -0.39 -0.52

Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0003677 DNA binding IEA -
GO:0003682 chromatin binding IEA -
GO:0003690 double-stranded DNA binding IEA -
GO:0005515 protein binding 新闻学会 14667819|16696853
GO:0008270 zinc ion binding IEA -
GO:0016564 transcription repressor activity NAS 9278495
GO:0016563 transcription activator activity NAS 9278495
去:0046872 metal ion binding IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0001779 natural killer cell differentiation IEA -
GO:0006355 regulation of transcription, DNA-dependent IDA 12560508
GO:0030224 monocyte differentiation IEA -
GO:0006350 transcription IEA -
GO:0030218 erythrocyte differentiation IEA -
GO:0030217 T cell differentiation IEA -
GO:0030851 granulocyte differentiation IEA -
GO:0030183 B cell differentiation IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005622 intracellular IEA -
GO:0005634 nucleus IC 12560508

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
E2F1 E2F-1 | RBAP1 | RBBP3 | RBP3 E2F transcription factor 1 - HPRD,BioGRID 10547281
GABPA E4TF1-60 | E4TF1A | NFT2 | NRF2 | NRF2A GA binding protein transcription factor, alpha subunit 60kDa - HPRD,BioGRID 11237613
GRIN1 NMDA1 | NMDAR1 | NR1 glutamate receptor, ionotropic, N-methyl D-aspartate 1 - HPRD 14970236
HDAC1 DKFZp686H12203 | GON-10 | HD1 | RPD3 | RPD3L1 histone deacetylase 1 - HPRD,BioGRID 12176973
HDAC2 RPD3 | YAF1 histone deacetylase 2 - HPRD,BioGRID 12151407
PIAS1 DDXBP1 | GBP | GU/RH-II | MGC141878 | MGC141879 | ZMIZ3 protein inhibitor of activated STAT, 1 - HPRD,BioGRID 12356736
RB1 OSRC | RB | p105-Rb | pRb | pp110 retinoblastoma 1 - HPRD 7732011
RBBP4 NURF55 | RBAP48 retinoblastoma binding protein 4 Affinity Capture-Western BioGRID 12091390
RBBP4 NURF55 | RBAP48 retinoblastoma binding protein 4 - HPRD 12943729
SENP1 SuPr-2 SUMO1/sentrin specific peptidase 1 SENP1 desumoylates sumoylated SP3. This interaction was modeled on a demonstrated interaction between SENP1 from an unspecified species and SP3 from an unspecified species. BIND 15546615
SP1 - Sp1 transcription factor - HPRD 9329821
SP4 HF1B | MGC130008 | MGC130009 | SPR-1 Sp4 transcription factor Phenotypic Suppression BioGRID 7559627
STK19 D6S60 | D6S60E | G11 | HLA-RP1 | MGC117388 | RP1 serine/threonine kinase 19 - HPRD,BioGRID 14667819
TNFSF10 APO2L | Apo-2L | CD253 | TL2 | TRAIL tumor necrosis factor (ligand) superfamily, member 10 SP3 interacts with the TNFSF10 promoter. BIND 15619633
ZBTB7A DKFZp547O146 | FBI-1 | FBI1 | LRF | MGC99631 | ZBTB7 | ZNF857A | pokemon zinc finger and BTB domain containing 7A - HPRD 12004059


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
BIOCARTA CALCINEURIN PATHWAY 21 17 All SZGR 2.0 genes in this pathway
PID SMAD2 3NUCLEAR PATHWAY 82 63 All SZGR 2.0 genes in this pathway
PID TELOMERASE PATHWAY 68 48 All SZGR 2.0 genes in this pathway
RODRIGUES DCC TARGETS DN 121 84 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP 276 165 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 UP 341 197 All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES SKIN UP 177 113 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN 770 415 All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION 77 51 All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION CCNE1 40 26 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN 855 609 All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442 892 All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN 848 527 All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN 1024 594 All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION UP 195 138 All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP 424 268 All SZGR 2.0 genes in this pathway
IIZUKA LIVER CANCER PROGRESSION G1 G2 DN 25 18 All SZGR 2.0 genes in this pathway
CHESLER BRAIN HIGHEST EXPRESSION 40 29 All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP 555 346 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP 390 242 All SZGR 2.0 genes in this pathway
WESTON VEGFA TARGETS 6HR 59 38 All SZGR 2.0 genes in this pathway
WESTON VEGFA TARGETS 12HR 35 23 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 1691 1088 All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 12 36 18 All SZGR 2.0 genes in this pathway
YIH RESPONSE TO ARSENITE C2 18 15 All SZGR 2.0 genes in this pathway
WESTON VEGFA TARGETS 108 71 All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C0 107 72 All SZGR 2.0 genes in this pathway
MMS MOUSE LYMPH HIGH 4HRS UP 36 20 All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN 318 220 All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G6 153 112 All SZGR 2.0 genes in this pathway
WESTON VEGFA TARGETS 3HR 74 47 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP 953 554 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP 783 442 All SZGR 2.0 genes in this pathway
RIGGINS TAMOXIFEN RESISTANCE DN 220 147 All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY GAMMA RADIATION 81 59 All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE UP 226 164 All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS DN 120 81 All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA UP 207 143 All SZGR 2.0 genes in this pathway
DANG REGULATED BY MYC DN 253 192 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS DN 553 343 All SZGR 2.0 genes in this pathway
VANLOO SP3 TARGETS DN 89 47 All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D 658 397 All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B 517 302 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-124.1 141 147 m8 hsa-miR-124a UUAAGGCACGCGGUGAAUGCCA
hsa-miR-124a UUAAGGCACGCGGUGAAUGCCA
miR-124/506 141 147 1A hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brain UAAGGCACGCGGUGAAUGCC
miR-129-5p 93 99 m8 hsa-miR-129brain CUUUUUGCGGUCUGGGCUUGC
hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGCU
hsa-miR-129brain CUUUUUGCGGUCUGGGCUUGC
hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGCU
miR-133 801 807 1A hsa-miR-133a UUGGUCCCCUUCAACCAGCUGU
hsa-miR-133b UUGGUCCCCUUCAACCAGCUA
miR-135 886 892 m8 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUG
hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUG
miR-145 418 424 1A hsa-miR-145 GUCCAGUUUUCCCAGGAAUCCCUU
miR-153 920 926 1A hsa-miR-153 UUGCAUAGUCACAAAAGUGA
miR-155 554 560 m8 hsa-miR-155 UUAAUGCUAAUCGUGAUAGGGG
miR-182 654 661 1A,m8 hsa-miR-182 UUUGGCAAUGGUAGAACUCACA
miR-186 678 684 m8 hsa-miR-186 CAAAGAAUUCUCCUUUUGGGCUU
miR-188 603 609 1A hsa-miR-188 CAUCCCUUGCAUGGUGGAGGGU
miR-194 466 472 1A hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
miR-208 825 831 m8 hsa-miR-208 AUAAGACGAGCAAAAAGCUUGU
miR-223 439 446 1A,m8 hsa-miR-223 UGUCAGUUUGUCAAAUACCCC
miR-30-3p 134 140 m8 hsa-miR-30a-3p CUUUCAGUCGGAUGUUUGCAGC
hsa-miR-30e-3p CUUUCAGUCGGAUGUUUACAGC
miR-363 91 97 1A hsa-miR-363 AUUGCACGGUAUCCAUCUGUAA
miR-369-3p 1362 1369 1A,m8 hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
miR-374 1363 1370 1A,m8 hsa-miR-374 UUAUAAUACAACCUGAUAAGUG
miR-410 241 248 1A,m8 hsa-miR-410 AAUAUAACACAGAUGGCCUGU
miR-448 919 926 1A,m8 hsa-miR-448 UUGCAUAUGUAGGAUGUCCCAU
miR-450 93 99 1A hsa-miR-450 UUUUUGCGAUGUGUUCCUAAUA
miR-452 922 929 1A,m8 hsa-miR-452 UGUUUGCAGAGGAAACUGAGAC
miR-485-3p 151 157 m8 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU
miR-493-5p 539 546 1A,m8 hsa-miR-493-5p UUGUACAUGGUAGGCUUUCAUU
hsa-miR-493-5p UUGUACAUGGUAGGCUUUCAUU
miR-505 626 632 1A hsa-miR-505 GUCAACACUUGCUGGUUUCCUC
miR-543 464 470 1A hsa-miR-543 AAACAUUCGCGGUGCACUUCU
miR-93.hd/291-3p/294/295/302/372/373/520 1048 1054 1A hsa-miR-93brain AAAGUGCUGUUCGUGCAGGUAG
hsa-miR-302a UAAGUGCUUCCAUGUUUUGGUGA
hsa-miR-302b UAAGUGCUUCCAUGUUUUAGUAG
hsa-miR-302c UAAGUGCUUCCAUGUUUCAGUGG
hsa-miR-302d UAAGUGCUUCCAUGUUUGAGUGU
hsa-miR-372 AAAGUGCUGCGACAUUUGAGCGU
hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU
hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
hsa-miR-520a AAAGUGCUUCCCUUUGGACUGU
hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
hsa-miR-520c AAAGUGCUUCCUUUUAGAGGGUU
hsa-miR-520d AAAGUGCUUCUCUUUGGUGGGUU
miR-96 655 661 1A hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC