Gene Page:STAC
Summary?
GeneID | 6769 |
Symbol | STAC |
Synonyms | STAC1 |
Description | SH3 and cysteine rich domain |
Reference | MIM:602317|HGNC:HGNC:11353|Ensembl:ENSG00000144681|HPRD:11890|Vega:OTTHUMG00000130798 |
Gene type | protein-coding |
Map location | 3p22.3 |
Pascal p-value | 0.004 |
eGene | Cerebellar Hemisphere Cerebellum Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_I | Genome scan meta-analysis | Psr: 0.006 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs1507047 | chr16 | 50932778 | STAC | 6769 | 0.1 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/STAC_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ICA1L | 0.86 | 0.89 |
LRRC7 | 0.85 | 0.88 |
SPIN3 | 0.85 | 0.88 |
FHOD3 | 0.84 | 0.89 |
RP11-791G16.2 | 0.84 | 0.87 |
MARK1 | 0.83 | 0.90 |
三人组 | 0.83 | 0.90 |
MAPKBP1 | 0.83 | 0.88 |
DOCK9 | 0.83 | 0.84 |
ALS2 | 0.83 | 0.89 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
TSC22D4 | -0.71 | -0.78 |
AF347015.31 | -0.71 | -0.80 |
FXYD1 | -0.70 | -0.79 |
HSD17B14 | -0.69 | -0.77 |
MT-CO2 | -0.69 | -0.78 |
AF347015.27 | -0.68 | -0.77 |
AF347015.33 | -0.68 | -0.75 |
AC021016.1 | -0.67 | -0.80 |
METRN | -0.67 | -0.81 |
HEPN1 | -0.67 | -0.72 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0008270 | zinc ion binding | IEA | - | |
GO:0019992 | diacylglycerol binding | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0007242 | intracellular signaling cascade | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005625 | soluble fraction | TAS | 8954993 | |
GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D DN | 205 | 127 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 AND HDAC2 TARGETS DN | 232 | 139 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
GOTZMANN EPITHELIAL TO MESENCHYMAL TRANSITION DN | 206 | 136 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
WANG TARGETS OF MLL CBP FUSION UP | 44 | 26 | All SZGR 2.0 genes in this pathway |
LENAOUR DENDRITIC CELL MATURATION UP | 114 | 84 | All SZGR 2.0 genes in this pathway |
YAGI AML FAB MARKERS | 191 | 131 | All SZGR 2.0 genes in this pathway |
RAMASWAMY METASTASIS DN | 61 | 47 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-30-5p | 1177 | 1184 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.