Gene Page:STAU1

Summary?
GeneID 6780
Symbol STAU1
Synonyms PPP1R150|STAU
Description staufen double-stranded RNA binding protein 1
Reference MIM:601716|HGNC:HGNC:11370|Ensembl:ENSG00000124214|HPRD:03422|Vega:OTTHUMG00000032691
Gene type protein-coding
Map location 20q13.1
Pascal p-value 0.002
Sherlock p-value 0.963
Fetal beta 0.639
eGene Frontal Cortex BA9
Support Potential synaptic genes

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search 系统搜索PubMed的基因co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0179

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
LGALS1 0.53 0.57
AGPAT2 0.51 0.53
MRPL41 0.50 0.53
MSRB2 0.50 0.57
PVALB 0.49 0.55
CRYBA2 0.48 0.53
SDF2L1 0.48 0.42
SMPX 0.47 0.43
SNCG 0.46 0.52
DAPL1 0.46 0.37
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AOF1 -0.42 -0.57
THOC2 -0.42 -0.59
MAP4K4 -0.42 -0.55
PTPN1 -0.42 -0.56
GNB4 -0.42 -0.57
PHF3 -0.41 -0.57
LATS1 -0.41 -0.57
TOP1 -0.41 -0.58
RSF1 -0.41 -0.56
HP1BP3 -0.41 -0.55

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003725 double-stranded RNA binding IEA -
GO:0003725 double-stranded RNA binding TAS 10022909
GO:0005515 protein binding 新闻学会 15303970|15680326
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0008298 intracellular mRNA localization IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005791 rough endoplasmic reticulum TAS 10022909
GO:0005875 microtubule associated complex TAS 10022909
GO:0005622 intracellular IEA -
GO:0030529 ribonucleoprotein complex IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
LIU SOX4 TARGETS DN 309 191 All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP 1382 904 All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION UP 119 66 All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN 485 334 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP 1142 669 All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN 514 319 All SZGR 2.0 genes in this pathway
WILLIAMS ESR2 TARGETS UP 28 18 All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS UP 292 168 All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION DN 517 309 All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP 424 268 All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS 882 572 All SZGR 2.0 genes in this pathway
PENG RAPAMYCIN RESPONSE DN 245 154 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 1691 1088 All SZGR 2.0 genes in this pathway
JIANG HYPOXIA NORMAL 311 205 All SZGR 2.0 genes in this pathway
MARTINEZ RESPONSE TO TRABECTEDIN DN 271 175 All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP 871 505 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-142-3p 1039 1046 1A,m8 hsa-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA
hsa-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA
miR-142-5p 1498 1505 1A,m8 hsa-miR-142-5p CAUAAAGUAGAAAGCACUAC
miR-326 458 464 1A hsa-miR-326 CCUCUGGGCCCUUCCUCCAG
miR-330 60 67 1A,m8 hsa-miR-330brain GCAAAGCACACGGCCUGCAGAGA
miR-361 80 86 m8 hsa-miR-361brain UUAUCAGAAUCUCCAGGGGUAC
miR-381 859 865 1A hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
miR-486 1043 1049 1A hsa-miR-486 UCCUGUACUGAGCUGCCCCGAG
miR-495 1360 1366 1A hsa-miR-495brain AAACAAACAUGGUGCACUUCUUU