Gene Page:VAMP1
Summary?
GeneID | 6843 |
Symbol | VAMP1 |
Synonyms | SPAX1|SYB1|VAMP-1 |
Description | vesicle associated membrane protein 1 |
Reference | MIM:185880|HGNC: HGNC: 12642|运用:ENSG00000139190|HPRD:01716|Vega:OTTHUMG00000168269 |
Gene type | protein-coding |
Map location | 12p |
Pascal p-value | 0.88 |
Sherlock p-value | 0.509 |
Fetal beta | -2.817 |
DMG | 1 (# studies) |
eGene | Cerebellar Hemisphere Cerebellum Myers' cis & trans |
Support | EXOCYTOSIS SEROTONIN Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenics,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg25750404 | 12 | 6579648 | VAMP1 | -0.022 | 0.45 | DMG:Nishioka_2013 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs10510196 | chr3 | 723427 | VAMP1 | 6843 | 0.04 | trans | ||
rs2131824 | chr6 | 125775939 | VAMP1 | 6843 | 0.01 | trans | ||
rs2248 | chr6 | 125777720 | VAMP1 | 6843 | 0.01 | trans | ||
rs2249 | chr6 | 125777752 | VAMP1 | 6843 | 0.01 | trans | ||
rs1494142 | chr6 | 125778157 | VAMP1 | 6843 | 0.07 | trans | ||
rs1494160 | chr6 | 125784791 | VAMP1 | 6843 | 0.01 | trans | ||
rs1494158 | chr6 | 125785156 | VAMP1 | 6843 | 0.01 | trans | ||
rs10860768 | chr12 | 102069497 | VAMP1 | 6843 | 0.17 | trans | ||
rs6096615 | chr20 | 50472392 | VAMP1 | 6843 | 0.01 | trans | ||
rs16999646 | chr21 | 25544091 | VAMP1 | 6843 | 0.19 | trans | ||
rs16999651 | chr21 | 25544635 | VAMP1 | 6843 | 0.09 | trans | ||
rs10482945 | chr21 | 25544889 | VAMP1 | 6843 | 0.18 | trans | ||
rs8130791 | chr21 | 25545446 | VAMP1 | 6843 | 0.18 | trans | ||
rs7887792 | chrX | 20508216 | VAMP1 | 6843 | 0 | trans | ||
rs5990879 | chrX | 20517507 | VAMP1 | 6843 | 0.01 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/VAMP1_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
COPZ1 | 0.84 | 0.82 |
C8orf41 | 0.83 | 0.83 |
DAP3 | 0.82 | 0.81 |
SPG21 | 0.82 | 0.81 |
CNBP | 0.82 | 0.79 |
CHCHD3 | 0.81 | 0.78 |
PRMT5 | 0.81 | 0.77 |
EIF3I | 0.81 | 0.80 |
USP39 | 0.81 | 0.80 |
VPS45 | 0.81 | 0.80 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.8 | -0.69 | -0.67 |
MT-CO2 | -0.69 | -0.67 |
AF347015.27 | -0.68 | -0.68 |
AF347015.21 | -0.66 | -0.64 |
AF347015.2 | -0.66 | -0.68 |
MT-CYB | -0.66 | -0.66 |
AF347015.15 | -0.65 | -0.67 |
AF347015.31 | -0.65 | -0.66 |
AF347015.26 | -0.64 | -0.66 |
AF347015.33 | -0.64 | -0.64 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | 新闻学会 | 9920726 | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0016192 | vesicle-mediated transport | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0019717 | synaptosome | IEA | Synap, Brain (GO term level: 7) | - |
GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
GO:0005739 | mitochondrion | IEA | - | |
GO:0005741 | mitochondrial outer membrane | IEA | - | |
GO:0016020 | membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | TAS | 1976629 | |
GO:0030054 | cell junction | IEA | - | |
GO:0031410 | cytoplasmic vesicle | IEA | - | |
GO:0030659 | cytoplasmic vesicle membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG SNARE INTERACTIONS IN VESICULAR TRANSPORT | 38 | 25 | All SZGR 2.0 genes in this pathway |
REACTOME BOTULINUM NEUROTOXICITY | 19 | 14 | All SZGR 2.0 genes in this pathway |
REACTOME PROTEOLYTIC CLEAVAGE OF SNARE COMPLEX PROTEINS | 17 | 12 | All SZGR 2.0 genes in this pathway |
REACTOME NEURONAL SYSTEM | 279 | 221 | All SZGR 2.0 genes in this pathway |
KORKOLA SEMINOMA UP | 44 | 27 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA UP | 177 | 110 | All SZGR 2.0 genes in this pathway |
加白血病STEM CELL DN | 244 | 153 | All SZGR 2.0 genes in this pathway |
OSMAN BLADDER CANCER DN | 406 | 230 | All SZGR 2.0 genes in this pathway |
HAHTOLA MYCOSIS FUNGOIDES CD4 DN | 116 | 71 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
PETRETTO HEART MASS QTL CIS UP | 28 | 15 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL AND BRAIN QTL TRANS | 185 | 114 | All SZGR 2.0 genes in this pathway |
HADDAD B LYMPHOCYTE PROGENITOR | 293 | 193 | All SZGR 2.0 genes in this pathway |
LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
LEE AGING NEOCORTEX UP | 89 | 59 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE INCIPIENT DN | 165 | 106 | All SZGR 2.0 genes in this pathway |
BILD MYC ONCOGENIC SIGNATURE | 206 | 117 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER NORMAL LIKE UP | 476 | 285 | All SZGR 2.0 genes in this pathway |
BLUM RESPONSE TO SALIRASIB DN | 342 | 220 | All SZGR 2.0 genes in this pathway |
LEE DIFFERENTIATING T LYMPHOCYTE | 200 | 115 | All SZGR 2.0 genes in this pathway |
GUTIERREZ CHRONIC LYMPHOCYTIC LEUKEMIA DN | 56 | 39 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
CHYLA CBFA2T3 TARGETS DN | 242 | 146 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS UP | 279 | 155 | All SZGR 2.0 genes in this pathway |
ZWANG DOWN BY 2ND EGF PULSE | 293 | 119 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-15/16/195/424/497 | 178 | 184 | m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click在这里to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click在这里to see the list of brain related miRNAs.