Gene Page:BTC

Summary?
GeneID 685
Symbol BTC
Synonyms -
Description betacellulin
Reference MIM:600345|HGNC:HGNC:1121|HPRD:02643|
Gene type protein-coding
Map location 4q13.3
Pascal p-value 0.005

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
Expression Meta-analysis of gene expression Pvalue: 1.409

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
RPL5 0.97 0.94
RPL4 0.96 0.97
NACA 0.96 0.96
ILF2 0.96 0.95
IGBP1 0.96 0.96
TUT1 0.96 0.90
EIF3H 0.96 0.93
C14orf166 0.96 0.92
RPS8 0.95 0.86
VPS72 0.95 0.93
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
HLA-F -0.69 -0.76
AIFM3 -0.67 -0.74
AF347015.27 -0.66 -0.82
FBXO2 -0.66 -0.66
AF347015.33 -0.65 -0.83
C5orf53 -0.65 -0.66
MT-CO2 -0.64 -0.81
TINAGL1 -0.64 -0.76
ATP10A -0.64 -0.72
MT-CYB -0.64 -0.82

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005154 epidermal growth factor receptor binding TAS 8144591
GO:0008083 growth factor activity TAS 8439318
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0008284 positive regulation of cell proliferation TAS 8144591
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005576 extracellular region IEA -
GO:0005625 soluble fraction TAS 8144591
GO:0016021 integral to membrane IEA -
GO:0005886 plasma membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG ERBB SIGNALING PATHWAY 87 71 All SZGR 2.0 genes in this pathway
PID ERBB4 PATHWAY 38 32 All SZGR 2.0 genes in this pathway
PID ERBB NETWORK PATHWAY 15 13 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ERBB4 90 67 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ERBB2 101 78 All SZGR 2.0 genes in this pathway
REACTOME GRB2 EVENTS IN ERBB2 SIGNALING 22 20 All SZGR 2.0 genes in this pathway
REACTOME PI3K EVENTS IN ERBB4 SIGNALING 38 28 All SZGR 2.0 genes in this pathway
REACTOME SHC1 EVENTS IN ERBB4 SIGNALING 20 17 All SZGR 2.0 genes in this pathway
REACTOME PI3K EVENTS IN ERBB2 SIGNALING 44 34 All SZGR 2.0 genes in this pathway
REACTOME NUCLEAR SIGNALING BY ERBB4 38 30 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821 933 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS DN 193 112 All SZGR 2.0 genes in this pathway
KIM MYCN AMPLIFICATION TARGETS UP 92 64 All SZGR 2.0 genes in this pathway
GOTZMANN EPITHELIAL TO MESENCHYMAL TRANSITION DN 206 136 All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215 893 528 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR 681 420 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP 673 430 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP 602 364 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP 601 369 All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER WITH H3K27ME3 UP 295 149 All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK 1210 725 All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 LCP WITH H3K4ME3 162 80 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF LCP WITH H3K4ME3 128 68 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 1HR DN 222 147 All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 2 DN 336 211 All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL DN 428 246 All SZGR 2.0 genes in this pathway
NABA SECRETED FACTORS 344 197 All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED 753 411 All SZGR 2.0 genes in this pathway
NABA MATRISOME 1028 559 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-378 77 83 1A hsa-miR-378 CUCCUGACUCCAGGUCCUGUGU