Gene Page:SYT5

Summary?
GeneID 6861
Symbol SYT5
Synonyms -
Description synaptotagmin 5
Reference MIM:600782|HGNC:HGNC:11513|HPRD:02870|
Gene type protein-coding
Map location 19q13.42|11p
Pascal p-value 0.013
Sherlock p-value 0.118
DEG p-value DEG:Maycox_2009:CC_BA10_fold_change=-1.22:CC_BA10_disease_P=0.0030:HBB_BA9_fold_change=-1.40:HBB_BA9_disease_P=0.0452
Fetal beta -1.008
DMG 1 (# studies)
eGene Cerebellar Hemisphere
Cerebellum
Myers' cis & trans
Support EXOCYTOSIS
G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS
G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL
G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS
G2Cdb.human_clathrin
G2Cdb.human_Synaptosome
CompositeSet

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DEG:Maycox_2009 Microarray to determine the expression of over 30000 mRNA transcripts in post-mortem tissue We included 51 genes whose expression changes are common between two schizophrenia cohorts.
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 4

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg22066304 19 55691730 SYT5 1.36E-5 0.373 0.014 DMG:Wockner_2014

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs6693235 chr1 120004691 SYT5 6861 0.02 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
WDR85 0.87 0.85
RHOT2 0.87 0.84
FBXL6 0.87 0.87
TUBGCP6 0.86 0.85
ANKS3 0.86 0.86
RP3-402G11.1 0.86 0.82
RFNG 0.85 0.87
ZNF276 0.85 0.85
CPT1B 0.85 0.81
CDK9 0.85 0.82
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.31 -0.58 -0.58
AF347015.27 -0.57 -0.58
AF347015.21 -0.55 -0.64
MT-CO2 -0.54 -0.56
MT-CYB -0.54 -0.54
AF347015.8 -0.53 -0.55
MT-ATP8 -0.50 -0.61
AF347015.15 -0.50 -0.52
AF347015.33 -0.49 -0.51
AF347015.2 -0.49 -0.53

Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0005509 calcium ion binding IEA -
GO:0005215 transporter activity IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007268 synaptic transmission TAS neuron, Synap, Neurotransmitter (GO term level: 6) 9177789
GO:0006810 transport IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0043025 cell soma IEA axon, dendrite (GO term level: 4) -
GO:0008021 synaptic vesicle IEA Synap, Neurotransmitter (GO term level: 12) -
GO:0043005 neuron projection IEA neuron, axon, neurite, dendrite (GO term level: 5) -
GO:0045202 synapse IEA neuron, Synap, Neurotransmitter, Glial (GO term level: 2) -
GO:0055038 recycling endosome membrane IEA -
GO:0005794 Golgi apparatus IDA 18029348
GO:0005768 endosome IEA -
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -
GO:0048471 perinuclear region of cytoplasm IEA -
GO:0030054 cell junction IEA -
GO:0031410 cytoplasmic vesicle IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
REACTOME集成的能量ABOLISM 120 84 All SZGR 2.0 genes in this pathway
REACTOME REGULATION OF INSULIN SECRETION 93 65 All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS UP 292 168 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237 837 All SZGR 2.0 genes in this pathway
XU GH1 EXOGENOUS TARGETS UP 85 50 All SZGR 2.0 genes in this pathway
FIRESTEIN PROLIFERATION 175 125 All SZGR 2.0 genes in this pathway
AGUIRRE PANCREATIC CANCER COPY NUMBER UP 298 174 All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3 718 401 All SZGR 2.0 genes in this pathway
LE NEURONAL DIFFERENTIATION UP 18 13 All SZGR 2.0 genes in this pathway
FOSTER KDM1A TARGETS UP 266 142 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-219 293 300 1A,m8 hsa-miR-219brain UGAUUGUCCAAACGCAAUUCU
miR-330 287 294 1A,m8 hsa-miR-330brain GCAAAGCACACGGCCUGCAGAGA