Gene Page:KLF5

Summary?
GeneID 688
Symbol KLF5
Synonyms BTEB2|CKLF|IKLF
Description Kruppel-like factor 5 (intestinal)
Reference MIM:602903|HGNC:HGNC:6349|Ensembl:ENSG00000102554|HPRD:04212|Vega:OTTHUMG00000017074
Gene type protein-coding
Map location 13q22.1
Pascal p-value 0.002
Fetal beta -0.376
eGene Cerebellar Hemisphere
Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association A combined odds ratio method (Sun et al. 2008), association studies 1 Link to SZGene
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs17131759 chr1 86495557 KLF5 688 0.04 trans
rs17131472 chr1 91962966 KLF5 688 0.07 trans
rs6710894 chr2 66876700 KLF5 688 0.04 trans
rs17046675 chr2 117922028 KLF5 688 0.16 trans
rs1691463 chr3 84914366 KLF5 688 0.17 trans
rs2922180 chr3 125280472 KLF5 688 0.05 trans
rs2976809 chr3 125451738 KLF5 688 0.04 trans
rs16889842 chr4 9872012 KLF5 688 0.01 trans
snp_a-1976228 0 KLF5 688 0.19 trans
rs313946 chr4 113975904 KLF5 688 0.03 trans
rs10050805 chr5 30805352 KLF5 688 0.09 trans
rs837115 chr5 40736290 KLF5 688 0.18 trans
rs17056435 chr5 158453782 KLF5 688 0.08 trans
rs6920042 chr6 67907570 KLF5 688 0.04 trans
rs6939897 chr6 67913123 KLF5 688 0.12 trans
rs6455226 chr6 67930295 KLF5 688 3.17E-4 trans
rs9451867 chr6 92659609 KLF5 688 0.07 trans
rs2398707 chr7 2113428 KLF5 688 0.02 trans
rs3778948 chr7 2123290 KLF5 688 0.1 trans
rs3778951 chr7 2125319 KLF5 688 0.02 trans
rs3778957 chr7 2127710 KLF5 688 0.02 trans
rs3778958 chr7 2127794 KLF5 688 0.1 trans
rs3778968 chr7 2139903 KLF5 688 0.1 trans
rs3823550 chr7 137346101 KLF5 688 0.09 trans
rs7823144 chr8 38028194 KLF5 688 0.16 trans
rs11783167 chr8 129102799 KLF5 688 0.18 trans
rs2253777 chr9 93467893 KLF5 688 0.03 trans
rs998410 chr9 117622673 KLF5 688 0.03 trans
rs10747972 0 KLF5 688 0.14 trans
rs11112163 chr12 105072508 KLF5 688 0.01 trans
rs1498763 chr12 115975789 KLF5 688 0.19 trans
rs4882759 chr12 128909713 KLF5 688 0.2 trans
rs9551590 chr13 29589464 KLF5 688 0.03 trans
rs10142086 chr14 35135892 KLF5 688 0.03 trans
rs1951867 chr14 54407191 KLF5 688 0.17 trans
rs2093759 chr14 97171024 KLF5 688 0.19 trans
rs17244419 chr14 97171074 KLF5 688 0.02 trans
rs7177212 chr15 34425413 KLF5 688 0.1 trans
rs17841422 chr17 20969134 KLF5 688 0.19 trans
rs11873703 chr18 61448702 KLF5 688 0.01 trans
rs6017989 chr20 45329846 KLF5 688 0.2 trans
rs6095741 chr20 48666589 KLF5 688 0.01 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003700 transcription factor activity IEA -
GO:0003702 RNA polymerase II transcription factor activity TAS 8479902
GO:0005515 protein binding IEA -
GO:0008270 子nc ion binding IEA -
GO:0046872 metal ion binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0001525 angiogenesis IEA -
GO:0006355 regulation of transcription, DNA-dependent IEA -
GO:0006366 transcription from RNA polymerase II promoter TAS 8479902
GO:0030033 microvillus biogenesis IEA -
GO:0045941 positive regulation of transcription IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005622 intracellular IEA -
GO:0005634 nucleus IEA -

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
CREBBP CBP | KAT3A | RSTS CREB binding protein - HPRD,BioGRID 12682370
EP300 KAT3B | p300 E1A binding protein p300 Affinity Capture-Western BioGRID 14612398
GTF2B TF2B | TFIIB general transcription factor IIB Reconstituted Complex BioGRID 9089417
GTF2E2 FE | TF2E2 | TFIIE-B general transcription factor IIE, polypeptide 2, beta 34kDa - HPRD 9089417
GTF2F1 BTF4 | RAP74 | TF2F1 | TFIIF general transcription factor IIF, polypeptide 1, 74kDa Reconstituted Complex BioGRID 9089417
GTF2F2 BTF4 | RAP30 | TF2F2 | TFIIF general transcription factor IIF, polypeptide 2, 30kDa - HPRD 9089417
NFKB1 DKFZp686C01211 | EBP-1 | KBF1 | MGC54151 | NF-kappa-B | NFKB-p105 | NFKB-p50 | p105 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 - HPRD,BioGRID 14573617
PRKCA AAG6 | MGC129900 | MGC129901 | PKC-alpha | PKCA | PRKACA protein kinase C, alpha Biochemical Activity BioGRID 12682370
RARA NR1B1 | RAR retinoic acid receptor, alpha in vitro
in vivo		 BioGRID 12101409
SET 2PP2A | I2PP2A | IGAAD | IPP2A2 | PHAPII | TAF-I | TAF-IBETA SET nuclear oncogene Affinity Capture-MS
Affinity Capture-Western
Reconstituted Complex		 BioGRID 14612398
TBP GTF2D | GTF2D1 | MGC117320 | MGC126054 | MGC126055 | SCA17 | TFIID TATA box binding protein Reconstituted Complex BioGRID 9089417


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
REACTOME DEVELOPMENTAL BIOLOGY 396 292 All SZGR 2.0 genes in this pathway
REACTOME TRANSCRIPTIONAL REGULATION OF WHITE ADIPOCYTE DIFFERENTIATION 72 53 All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN 634 384 All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA DN 526 357 All SZGR 2.0 genes in this pathway
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP 408 247 All SZGR 2.0 genes in this pathway
WILCOX RESPONSE TO PROGESTERONE UP 152 90 All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN 463 290 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP 485 293 All SZGR 2.0 genes in this pathway
LIU TARGETS OF VMYB VS CMYB DN 43 30 All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL DN 455 304 All SZGR 2.0 genes in this pathway
ROY WOUND BLOOD VESSEL DN 22 14 All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY UP 430 232 All SZGR 2.0 genes in this pathway
JAEGER METASTASIS DN 258 141 All SZGR 2.0 genes in this pathway
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS BLUE UP 136 80 All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 6HR UP 85 54 All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 3D UP 182 110 All SZGR 2.0 genes in this pathway
TIEN肠道益生菌2小时 27 19 All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 6HR UP 55 34 All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 24HR DN 214 133 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA UP 544 308 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LPS UP 431 237 All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER LMP UP 265 158 All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER GRADES 1 2 UP 137 84 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821 933 All SZGR 2.0 genes in this pathway
LIU CDX2 TARGETS UP 36 22 All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE UP 530 342 All SZGR 2.0 genes in this pathway
BERENJENO ROCK SIGNALING NOT VIA RHOA DN 48 34 All SZGR 2.0 genes in this pathway
VANHARANTA UTERINE FIBROID DN 67 45 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP 1142 669 All SZGR 2.0 genes in this pathway
BARIS THYROID CANCER DN 59 45 All SZGR 2.0 genes in this pathway
WANG BARRETTS ESOPHAGUS DN 25 13 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL TGFB1 TARGETS DN 62 44 All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION HEMGN 31 21 All SZGR 2.0 genes in this pathway
RASHI RESPONSE TO IONIZING RADIATION 2 127 92 All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS BASAL 330 217 All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER BASAL VS LULMINAL 330 215 All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER UP 358 245 All SZGR 2.0 genes in this pathway
KIM MYC AMPLIFICATION TARGETS DN 97 51 All SZGR 2.0 genes in this pathway
KIM MYCN AMPLIFICATION TARGETS DN 103 59 All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN 848 527 All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP 811 508 All SZGR 2.0 genes in this pathway
WU CELL MIGRATION 184 114 All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS 988 594 All SZGR 2.0 genes in this pathway
BENPORATH OCT4 TARGETS 290 172 All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS 734 436 All SZGR 2.0 genes in this pathway
BENPORATH NOS TARGETS 179 105 All SZGR 2.0 genes in this pathway
BENPORATH ES CORE NINE CORRELATED 100 68 All SZGR 2.0 genes in this pathway
AMIT SERUM RESPONSE 120 MCF10A 65 44 All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 DN 464 276 All SZGR 2.0 genes in this pathway
SMITH TERT TARGETS UP 145 91 All SZGR 2.0 genes in this pathway
HALMOS CEBPA TARGETS UP 52 34 All SZGR 2.0 genes in this pathway
NGUYEN NOTCH1 TARGETS DN 86 67 All SZGR 2.0 genes in this pathway
CROMER METASTASIS DN 81 58 All SZGR 2.0 genes in this pathway
TAVOR CEBPA TARGETS UP 48 36 All SZGR 2.0 genes in this pathway
TRAYNOR RETT SYNDROM DN 19 14 All SZGR 2.0 genes in this pathway
WANG CISPLATIN RESPONSE AND XPC DN 228 146 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 1691 1088 All SZGR 2.0 genes in this pathway
DELASERNA MYOD TARGETS UP 89 51 All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 3 101 64 All SZGR 2.0 genes in this pathway
TAKAO RESPONSE TO UVB RADIATION DN 98 67 All SZGR 2.0 genes in this pathway
MCCLUNG COCAIN REWARD 4WK 75 47 All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 UP 428 266 All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS PEAK AT 8HR 39 31 All SZGR 2.0 genes in this pathway
BILD HRAS ONCOGENIC SIGNATURE 261 166 All SZGR 2.0 genes in this pathway
OSADA ASCL1 TARGETS DN 24 20 All SZGR 2.0 genes in this pathway
MCCABE BOUND BY HOXC6 469 239 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BONE DN 315 197 All SZGR 2.0 genes in this pathway
乳腺癌萧述三腔的DN 564 326 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL UP 648 398 All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR DN 546 362 All SZGR 2.0 genes in this pathway
CHEN HOXA5 TARGETS 9HR UP 223 132 All SZGR 2.0 genes in this pathway
CONRAD STEM CELL 39 27 All SZGR 2.0 genes in this pathway
LEE LIVER CANCER SURVIVAL DN 175 103 All SZGR 2.0 genes in this pathway
LINDSTEDT DENDRITIC CELL MATURATION B 53 36 All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS UP 491 316 All SZGR 2.0 genes in this pathway
MELLMAN TUT1 TARGETS DN 47 29 All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS DN 442 275 All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S1 237 159 All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR DN 505 328 All SZGR 2.0 genes in this pathway
GABRIELY MIR21 TARGETS 289 187 All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS DN 242 146 All SZGR 2.0 genes in this pathway
DELPUECH FOXO3 TARGETS UP 68 49 All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN 882 538 All SZGR 2.0 genes in this pathway
PEDRIOLI MIR31 TARGETS DN 418 245 All SZGR 2.0 genes in this pathway
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL UP 289 184 All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 2HR UP 53 33 All SZGR 2.0 genes in this pathway
ZWANG CLASS 2 TRANSIENTLY INDUCED BY EGF 51 29 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-142-5p 534 540 1A hsa - mir - 142 - 5 - p CAUAAAGUAGAAAGCACUAC
miR-145 78 85 1A,m8 hsa-miR-145 GUCCAGUUUUCCCAGGAAUCCCUU
miR-153 1507 1514 1A,m8 hsa-miR-153 UUGCAUAGUCACAAAAGUGA
hsa-miR-153 UUGCAUAGUCACAAAAGUGA
hsa-miR-153 UUGCAUAGUCACAAAAGUGA
miR-182 1206 1212 1A hsa-miR-182 UUUGGCAAUGGUAGAACUCACA
miR-23 1158 1164 m8 hsa-miR-23abrain AUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrain AUCACAUUGCCAGGGAUUACC
miR-320 531 538 1A,m8 hsa-miR-320 AAAAGCUGGGUUGAGAGGGCGAA
miR-323 1157 1164 1A,m8 hsa-miR-323brain GCACAUUACACGGUCGACCUCU
miR-339 111 117 1A hsa-miR-339 UCCCUGUCCUCCAGGAGCUCA
miR-375 448 454 1A hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA
miR-410 1568 1574 1A hsa-miR-410 AAUAUAACACAGAUGGCCUGU
miR-448 521 528 1A,m8 hsa-miR-448 UUGCAUAUGUAGGAUGUCCCAU
hsa-miR-448 UUGCAUAUGUAGGAUGUCCCAU
hsa-miR-448 UUGCAUAUGUAGGAUGUCCCAU
miR-495 1338 1345 1A,m8 hsa-miR-495brain AAACAAACAUGGUGCACUUCUUU
miR-505 1108 1114 1A hsa-miR-505 GUCAACACUUGCUGGUUUCCUC
miR-9 1179 1185 m8 hsa-miR-9SZ UCUUUGGUUAUCUAGCUGUAUGA
hsa-miR-9SZ UCUUUGGUUAUCUAGCUGUAUGA
miR-96 1206 1212 1A hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC