Gene Page:TBX1
Summary?
GeneID | 6899 |
Symbol | TBX1 |
Synonyms | CAFS|CATCH22|CTHM|DGCR|DGS|DORV|TBX1C|TGA|VCF|VCFS |
Description | T-box 1 |
Reference | MIM:602054|HGNC:HGNC:11592|Ensembl:ENSG00000184058|HPRD:09069|Vega:OTTHUMG00000150421 |
Gene type | protein-coding |
Map location | 22q11.21 |
Pascal p-value | 0.177 |
Fetal beta | -0.747 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CNV:YES | Copy number variation studies | Manual curation | |
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | 系统搜索PubMed co-o基因ccurring with SCZ keywords. A total of 3027 genes were included. | |
Association | A combined odds ratio method (Sun et al. 2008), association studies | 2 | Link to SZGene |
GSMA_I | Genome scan meta-analysis | Psr: 0.031 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/TBX1_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
C4orf48 | 0.55 | 0.52 |
MRPS26 | 0.53 | 0.44 |
ALDH16A1 | 0.52 | 0.44 |
NME4 | 0.52 | 0.49 |
NOSIP | 0.52 | 0.42 |
ZNF787 | 0.52 | 0.48 |
AC018648.1 | 0.51 | 0.50 |
HSD17B10 | 0.51 | 0.39 |
MRPS34 | 0.51 | 0.39 |
C6orf226 | 0.51 | 0.42 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
UGP2 | -0.28 | -0.29 |
AKTIP | -0.27 | -0.30 |
GALNTL5 | -0.27 | -0.28 |
CHN1 | -0.27 | -0.21 |
FRG1B | -0.27 | -0.32 |
EFR3A | -0.26 | -0.29 |
ZNF365 | -0.26 | -0.26 |
OSBPL1A | -0.26 | -0.25 |
VSNL1 | -0.26 | -0.19 |
ELL2 | -0.26 | -0.26 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | IDA | 11111039 | |
GO:0003702 | RNA polymerase II transcription factor activity | NAS | 9268629 | |
GO:0042803 | protein homodimerization activity | IDA | 11111039 | |
GO:0043565 | sequence-specific DNA binding | IDA | 11111039 | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0006357 | regulation of transcription from RNA polymerase II promoter | NAS | 9268629 | |
GO:0007507 | heart development | IMP | 14585638 | |
GO:0060037 | pharyngeal system development | IMP | 14585638 | |
GO:0060017 | parathyroid gland development | IMP | 14585638 | |
GO:0048703 | embryonic viscerocranium morphogenesis | IMP | 14585638 | |
GO:0048538 | thymus development | IMP | 14585638 | |
GO:0060023 | soft palate development | IMP | 14585638 | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IDA | 15703190 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS GREY DN | 74 | 44 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
SCHLESINGER METHYLATED DE NOVO IN CANCER | 88 | 64 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD UP | 131 | 87 | All SZGR 2.0 genes in this pathway |
KAAB HEART ATRIUM VS VENTRICLE DN | 261 | 183 | All SZGR 2.0 genes in this pathway |
BRUNEAU SEPTATION VENTRICULAR | 10 | 8 | All SZGR 2.0 genes in this pathway |
BRUNEAU HEART GREAT VESSELS AND VALVULOGENESIS | 8 | 8 | All SZGR 2.0 genes in this pathway |
COLINA TARGETS OF 4EBP1 AND 4EBP2 | 356 | 214 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K27ME3 | 269 | 159 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH 11Q23 REARRANGED | 351 | 238 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
KESHELAVA MULTIPLE DRUG RESISTANCE | 88 | 56 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 NOT SATB1 DN | 448 | 282 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-101 | 413 | 419 | 1A | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
miR-139 | 414 | 421 | 1A,m8 | hsa-miR-139brain | UCUACAGUGCACGUGUCU |
miR-144 | 412 | 419 | 1A,m8 | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
miR-182 | 266 | 272 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-96 | 265 | 272 | 1A,m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.