Gene Page:TCF7

Summary?
GeneID 6932
Symbol TCF7
Synonyms TCF-1
Description transcription factor 7 (T-cell specific, HMG-box)
Reference MIM:189908|HGNC:HGNC:11639|Ensembl:ENSG00000081059|HPRD:01797|Vega:OTTHUMG00000129124
Gene type protein-coding
Map location 5q31.1
Pascal p-value 0.66
Sherlock p-value 0.542
Fetal beta 0.257
DMG 2 (# studies)
eGene Cerebellar Hemisphere
Cerebellum
Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 2
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 2
PMID:cooccur High-throughput literature-search 系统搜索PubMed的基因co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I Genome scan meta-analysis Psr: 0.0032
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg17487170 5 133451259 TCF7 4.868E-4 0.235 0.047 DMG:Wockner_2014
cg01116966 5 133450017 TCF7 2.01E-11 -0.028 3.47E-7 DMG:Jaffe_2016

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs2716734 chr2 39947720 TCF7 6932 0.02 trans
rs2716736 chr2 39947946 TCF7 6932 0.02 trans
rs12255258 chr10 106306927 TCF7 6932 0.02 trans
rs1241940 chr14 84008851 TCF7 6932 0.2 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

分子功能 去的术语 Evidence Neuro keywords PubMed ID
GO:0003677 DNA binding IEA -
GO:0003702 RNA polymerase II transcription factor activity TAS 1569101
GO:0005515 protein binding 新闻学会 9783587
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006357 regulation of transcription from RNA polymerase II promoter TAS 1569101
GO:0006350 transcription IEA -
GO:0016055 Wnt receptor signaling pathway IEA -
GO:0006955 immune response TAS 1569101
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG WNT SIGNALING PATHWAY 151 112 All SZGR 2.0 genes in this pathway
KEGG ADHERENS JUNCTION 75 53 All SZGR 2.0 genes in this pathway
KEGG MELANOGENESIS 102 80 All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER 328 259 All SZGR 2.0 genes in this pathway
KEGG COLORECTAL CANCER 62 47 All SZGR 2.0 genes in this pathway
KEGG ENDOMETRIAL CANCER 52 45 All SZGR 2.0 genes in this pathway
KEGG PROSTATE CANCER 89 75 All SZGR 2.0 genes in this pathway
KEGG THYROID CANCER 29 26 All SZGR 2.0 genes in this pathway
KEGG BASAL CELL CARCINOMA 55 44 All SZGR 2.0 genes in this pathway
KEGG ACUTE MYELOID LEUKEMIA 60 47 All SZGR 2.0 genes in this pathway
KEGG ARRHYTHMOGENIC RIGHT VENTRICULAR CARDIOMYOPATHY ARVC 76 59 All SZGR 2.0 genes in this pathway
WNT SIGNALING 89 71 All SZGR 2.0 genes in this pathway
PID BETA CATENIN NUC PATHWAY 80 60 All SZGR 2.0 genes in this pathway
HUTTMANN B CLL POOR SURVIVAL DN 60 39 All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA DN 116 79 All SZGR 2.0 genes in this pathway
BILBAN B CLL LPL DN 42 25 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 DN 126 86 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 2 DN 77 46 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 DN 162 116 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP 1142 669 All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP 612 367 All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS C UP 170 114 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 3 4WK DN 39 27 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 5 6WK UP 116 68 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 6 7WK UP 197 135 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL TGFB1 TARGETS DN 62 44 All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 2B 392 251 All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN 2FC UP 14 7 All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP 479 299 All SZGR 2.0 genes in this pathway
PUJANA BRCA2 PCC NETWORK 423 265 All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP 1037 673 All SZGR 2.0 genes in this pathway
LIU COMMON CANCER GENES 79 47 All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215 893 528 All SZGR 2.0 genes in this pathway
FERRANDO TAL1 NEIGHBORS 21 15 All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS UP 126 84 All SZGR 2.0 genes in this pathway
HASLINGER B CLL WITH MUTATED VH GENES 18 14 All SZGR 2.0 genes in this pathway
FERRANDO T ALL WITH MLL ENL FUSION UP 87 67 All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION 475 313 All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA DN 41 27 All SZGR 2.0 genes in this pathway
KUMAR TARGETS OF MLL AF9 FUSION 405 264 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 1691 1088 All SZGR 2.0 genes in this pathway
YAMAZAKI TCEB3 TARGETS DN 215 132 All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN 287 208 All SZGR 2.0 genes in this pathway
TSENG IRS1 TARGETS UP 113 71 All SZGR 2.0 genes in this pathway
TSENG ADIPOGENIC POTENTIAL UP 30 19 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 2 473 224 All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER P3 160 103 All SZGR 2.0 genes in this pathway
SANSOM WNT PATHWAY REQUIRE MYC 58 43 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP 673 430 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP 602 364 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP 601 369 All SZGR 2.0 genes in this pathway
GRADE COLON AND RECTAL CANCER UP 285 167 All SZGR 2.0 genes in this pathway
MARSHALL VIRAL INFECTION RESPONSE DN 29 21 All SZGR 2.0 genes in this pathway
VANASSE BCL2 TARGETS DN 74 50 All SZGR 2.0 genes in this pathway
LEE DIFFERENTIATING T LYMPHOCYTE 200 115 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 491 319 All SZGR 2.0 genes in this pathway
CHIARETTI T ALL REFRACTORY TO THERAPY 30 18 All SZGR 2.0 genes in this pathway
LI INDUCED T TO NATURAL KILLER DN 116 83 All SZGR 2.0 genes in this pathway
DURAND STROMA NS UP 162 103 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-133 624 630 1A hsa-miR-133a UUGGUCCCCUUCAACCAGCUGU
hsa-miR-133b UUGGUCCCCUUCAACCAGCUA
miR-192/215 531 537 m8 hsa-miR-192 CUGACCUAUGAAUUGACAGCC
hsa-miR-215 AUGACCUAUGAAUUGACAGAC
miR-24 1304 1310 1A hsa-miR-24SZ UGGCUCAGUUCAGCAGGAACAG
miR-491 59 66 1A,m8 hsa-miR-491brain AGUGGGGAACCCUUCCAUGAGGA
miR-9 1769 1775 1A hsa-miR-9SZ UCUUUGGUUAUCUAGCUGUAUGA
hsa-miR-9SZ UCUUUGGUUAUCUAGCUGUAUGA