Gene Page:TCN2

Summary?
GeneID 6948
Symbol TCN2
Synonyms D22S676|D22S750|II|TC|TC II|TC-2|TC2|TCII
Description transcobalamin 2
Reference MIM:613441|HGNC:HGNC:11653|Ensembl:ENSG00000185339|HPRD:02037|Vega:OTTHUMG00000151095
Gene type protein-coding
Map location 22q12.2
Pascal p-value 0.024
Sherlock p-value 0.367
Fetal beta -0.483
eGene 元

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search 系统搜索PubMed的genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I Genome scan meta-analysis Psr: 0.031
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
TPD52 0.91 0.91
ENPP5 0.88 0.89
REEP5 0.88 0.89
SNX10 0.87 0.90
ATP1B1 0.87 0.91
EPDR1 0.87 0.90
KRT222P 0.86 0.83
CCNDBP1 0.86 0.86
NSF 0.86 0.89
RCAN2 0.86 0.90
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
BCL7C -0.45 -0.53
NME4 -0.45 -0.55
SH3BP2 -0.45 -0.45
RBMX2 -0.43 -0.43
PDE9A -0.43 -0.39
SH2D2A -0.42 -0.45
RPL28 -0.42 -0.51
RPL18 -0.41 -0.48
RPS19P3 -0.41 -0.49
SH2B2 -0.41 -0.42

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0015087 cobalt ion transmembrane transporter activity IEA -
GO:0031419 cobalamin binding IEA -
GO:0050897 cobalt ion binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006824 cobalt ion transport IEA -
GO:0006811 ion transport IEA -
GO:0015889 cobalamin transport IEA -
GO:0015889 cobalamin transport TAS 3782074
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005576 extracellular region IEA -
GO:0005615 extracellular space TAS 1708393

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
HORIUCHI WTAP TARGETS UP 306 188 All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS B UP 26 16 All SZGR 2.0 genes in this pathway
WANG BARRETTS ESOPHAGUS UP 51 27 All SZGR 2.0 genes in this pathway
CEBALLOS TARGETS OF TP53 AND MYC DN 38 31 All SZGR 2.0 genes in this pathway
SHEPARD BMYB MORPHOLINO DN 200 112 All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP 398 262 All SZGR 2.0 genes in this pathway
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD DN 162 102 All SZGR 2.0 genes in this pathway
PETROVA PROX1 TARGETS DN 64 38 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP 390 242 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 1691 1088 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS INTERMEDIATE PROGENITOR 149 84 All SZGR 2.0 genes in this pathway
LEIN CHOROID PLEXUS MARKERS 103 61 All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER UP 973 570 All SZGR 2.0 genes in this pathway
MOOTHA PGC 420 269 All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER ESR1 DN 240 153 All SZGR 2.0 genes in this pathway
HOFFMANN PRE BI TO LARGE PRE BII LYMPHOCYTE DN 75 61 All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR UP 221 150 All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR UP 293 203 All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS UP 108 78 All SZGR 2.0 genes in this pathway
ZHAN V1 LATE DIFFERENTIATION GENES UP 32 25 All SZGR 2.0 genes in this pathway
JISON SICKLE CELL DISEASE UP 181 106 All SZGR 2.0 genes in this pathway
DANG REGULATED BY MYC DN 253 192 All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3 718 401 All SZGR 2.0 genes in this pathway
MIKKELSEN NPC ICP WITH H3K4ME3 445 257 All SZGR 2.0 genes in this pathway
WU APOPTOSIS BY CDKN1A VIA TP53 55 31 All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP 387 225 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP 745 475 All SZGR 2.0 genes in this pathway
KATSANOU ELAVL1 TARGETS UP 169 105 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839 928 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-214 90 96 m8 hsa-miR-214brain ACAGCAGGCACAGACAGGCAG