Gene Page:TGIF1
Summary?
GeneID | 7050 |
Symbol | TGIF1 |
Synonyms | HPE4|TGIF |
Description | TGFB induced factor homeobox 1 |
Reference | MIM:602630|HGNC:HGNC:11776|Ensembl:ENSG00000177426|HPRD:04023|Vega:OTTHUMG00000131511 |
Gene type | protein-coding |
Map location | 18p11.3 |
Pascal p-value | 0.178 |
Sherlock p-value | 0.285 |
Fetal beta | 1.534 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | 这个数据集包括2104探针/论文认定相关with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg09124190 | 18 | 3448419 | TGIF1 | 1.82E-10 | -0.023 | 5.29E-7 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/TGIF1_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SH2D5 | 0.73 | 0.75 |
SPOCK3 | 0.70 | 0.74 |
LIPA | 0.68 | 0.72 |
CNTNAP4 | 0.68 | 0.65 |
SLC22A15 | 0.67 | 0.65 |
CD55 | 0.67 | 0.76 |
PAM | 0.66 | 0.73 |
DKK3 | 0.66 | 0.62 |
TRIM66 | 0.66 | 0.65 |
PRIMA1 | 0.65 | 0.71 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SLA | -0.44 | -0.31 |
KLHL1 | -0.44 | -0.30 |
DACT1 | -0.43 | -0.31 |
TMEM108 | -0.43 | -0.35 |
NEUROD6 | -0.41 | -0.37 |
CSRP2 | -0.41 | -0.54 |
SCUBE1 | -0.41 | -0.48 |
MPPED1 | -0.41 | -0.31 |
SNX7 | -0.40 | -0.35 |
SATB2 | -0.40 | -0.29 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | TAS | 8537382 | |
GO:0003714 | transcription corepressor activity | TAS | 10764806 | |
GO:0005515 | protein binding | 新闻学会 | 17353931 | |
GO:0043565 | sequence-specific DNA binding | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0000122 | negative regulation of transcription from RNA polymerase II promoter | TAS | 10764806 | |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0007275 | multicellular organismal development | TAS | 8537382 | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
C1orf103 | FLJ11269 | RIF1 | RP11-96K19.1 | chromosome 1 open reading frame 103 | Two-hybrid | BioGRID | 16169070 |
CTBP1 | BARS | MGC104684 | C-terminal binding protein 1 | - | HPRD,BioGRID | 10995736 |
CTBP2 | - | C-terminal binding protein 2 | Two-hybrid | BioGRID | 16189514 |
EEF1A1 | CCS-3 | CCS3 | EEF-1 | EEF1A | EF-Tu | EF1A | FLJ25721 | GRAF-1EF | HNGC:16303 | LENG7 | MGC102687 | MGC131894 | MGC16224 | PTI1 | eEF1A-1 | eukaryotic translation elongation factor 1 alpha 1 | Two-hybrid | BioGRID | 16169070 |
FOXH1 | FAST-1 | FAST1 | forkhead box H1 | Affinity Capture-Western | BioGRID | 10199400 |
HDAC1 | DKFZp686H12203 | GON-10 | HD1 | RPD3 | RPD3L1 | histone deacetylase 1 | Affinity Capture-Western | BioGRID | 10995736|11427533 |
JUN | AP-1 | AP1 | c-Jun | jun oncogene | - | HPRD,BioGRID | 11371641 |
MED31 | 3110004H13Rik | CGI-125 | FLJ27436 | FLJ36714 | Soh1 | mediator complex subunit 31 | Two-hybrid | BioGRID | 16169070 |
MKKS | BBS6 | HMCS | KMS | MKS | McKusick-Kaufman syndrome | Affinity Capture-MS | BioGRID | 17353931 |
SDAD1 | DKFZp686E22207 | FLJ10498 | SDA1 domain containing 1 | Affinity Capture-MS | BioGRID | 17353931 |
SMAD1 | BSP1 | JV4-1 | JV41 | MADH1 | MADR1 | SMAD家庭member 1 | Affinity Capture-Western | BioGRID | 10199400 |
SMAD2 | JV18 | JV18-1 | MADH2 | MADR2 | MGC22139 | MGC34440 | hMAD-2 | hSMAD2 | SMAD家庭member 2 | - | HPRD,BioGRID | 10199400 |
SMAD3 | DKFZp586N0721 | DKFZp686J10186 | HSPC193 | HsT17436 | JV15-2 | MADH3 | MGC60396 | SMAD家庭成员3 | Affinity Capture-Western | BioGRID | 11427533 |
STK16 | FLJ39635 | KRCT | MPSK | PKL12 | TSF1 | serine/threonine kinase 16 | Affinity Capture-MS | BioGRID | 17353931 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID SMAD2 3NUCLEAR PATHWAY | 82 | 63 | All SZGR 2.0 genes in this pathway |
PID AR PATHWAY | 61 | 46 | All SZGR 2.0 genes in this pathway |
REACTOME SMAD2 SMAD3 SMAD4 HETEROTRIMER REGULATES TRANSCRIPTION | 27 | 17 | All SZGR 2.0 genes in this pathway |
REACTOME TRANSCRIPTIONAL ACTIVITY OF SMAD2 SMAD3 SMAD4 HETEROTRIMER | 38 | 26 | All SZGR 2.0 genes in this pathway |
REACTOME DOWNREGULATION OF SMAD2 3 SMAD4 TRANSCRIPTIONAL ACTIVITY | 20 | 14 | All SZGR 2.0 genes in this pathway |
REACTOME GENERIC TRANSCRIPTION PATHWAY | 352 | 181 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY TGF BETA RECEPTOR COMPLEX | 63 | 42 | All SZGR 2.0 genes in this pathway |
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP | 255 | 177 | All SZGR 2.0 genes in this pathway |
LIU CMYB TARGETS UP | 165 | 106 | All SZGR 2.0 genes in this pathway |
RODRIGUES DCC TARGETS DN | 121 | 84 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS DN | 459 | 276 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA UP | 536 | 340 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 3 4WK UP | 214 | 144 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 4 5WK UP | 271 | 175 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 6 7WK DN | 79 | 54 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL TGFB1 TARGETS UP | 169 | 127 | All SZGR 2.0 genes in this pathway |
RASHI RESPONSE TO IONIZING RADIATION 2 | 127 | 92 | All SZGR 2.0 genes in this pathway |
EINAV INTERFERON SIGNATURE IN CANCER | 27 | 16 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
BORLAK LIVER CANCER EGF UP | 57 | 41 | All SZGR 2.0 genes in this pathway |
TSAI RESPONSE TO IONIZING RADIATION | 149 | 101 | All SZGR 2.0 genes in this pathway |
GROSS HYPOXIA VIA ELK3 DN | 156 | 106 | All SZGR 2.0 genes in this pathway |
GROSS HYPOXIA VIA HIF1A DN | 110 | 78 | All SZGR 2.0 genes in this pathway |
GROSS HYPOXIA VIA ELK3 AND HIF1A UP | 142 | 104 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
BENPORATH CYCLING GENES | 648 | 385 | All SZGR 2.0 genes in this pathway |
AMIT SERUM RESPONSE 60 MCF10A | 57 | 42 | All SZGR 2.0 genes in this pathway |
SHIPP DLBCL CURED VS FATAL DN | 45 | 30 | All SZGR 2.0 genes in this pathway |
SMITH TERT TARGETS UP | 145 | 91 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS PLASMABLAST UP | 398 | 262 | All SZGR 2.0 genes in this pathway |
BROCKE APOPTOSIS REVERSED BY IL6 | 144 | 98 | All SZGR 2.0 genes in this pathway |
CHEOK RESPONSE TO HD MTX DN | 24 | 18 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS UP | 126 | 84 | All SZGR 2.0 genes in this pathway |
HADDAD B LYMPHOCYTE PROGENITOR | 293 | 193 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA CD2 UP | 45 | 32 | All SZGR 2.0 genes in this pathway |
YAGI AML FAB MARKERS | 191 | 131 | All SZGR 2.0 genes in this pathway |
GENTILE UV RESPONSE CLUSTER D9 | 28 | 15 | All SZGR 2.0 genes in this pathway |
RHODES CANCER META SIGNATURE | 64 | 47 | All SZGR 2.0 genes in this pathway |
WANG CISPLATIN RESPONSE AND XPC DN | 228 | 146 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV SCC DN | 123 | 86 | All SZGR 2.0 genes in this pathway |
YAMAZAKI TCEB3 TARGETS DN | 215 | 132 | All SZGR 2.0 genes in this pathway |
LU AGING BRAIN UP | 262 | 186 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
JIANG HYPOXIA CANCER | 83 | 52 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 6HR DN | 160 | 101 | All SZGR 2.0 genes in this pathway |
LEE AGING MUSCLE UP | 45 | 33 | All SZGR 2.0 genes in this pathway |
MARTINEZ RESPONSE TO TRABECTEDIN DN | 271 | 175 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
GAVIN FOXP3 TARGETS CLUSTER P3 | 160 | 103 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
MARSON FOXP3 TARGETS STIMULATED UP | 29 | 19 | All SZGR 2.0 genes in this pathway |
MARSON FOXP3 CORE DIRECT TARGETS | 19 | 14 | All SZGR 2.0 genes in this pathway |
GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
LABBE TGFB1 TARGETS UP | 102 | 64 | All SZGR 2.0 genes in this pathway |
CUI GLUCOSE DEPRIVATION | 60 | 44 | All SZGR 2.0 genes in this pathway |
MUELLER PLURINET | 299 | 189 | All SZGR 2.0 genes in this pathway |
MARSHALL VIRAL INFECTION RESPONSE DN | 29 | 21 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS UP | 491 | 316 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA CHEMOTAXIS DN | 457 | 302 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G3 UP | 188 | 121 | All SZGR 2.0 genes in this pathway |
COULOUARN TEMPORAL TGFB1 SIGNATURE UP | 109 | 68 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH T 8 21 TRANSLOCATION | 368 | 247 | All SZGR 2.0 genes in this pathway |
MARSON FOXP3 TARGETS DN | 54 | 38 | All SZGR 2.0 genes in this pathway |
CAIRO LIVER DEVELOPMENT UP | 166 | 105 | All SZGR 2.0 genes in this pathway |
WONG EMBRYONIC STEM CELL CORE | 335 | 193 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 6 | 75 | 48 | All SZGR 2.0 genes in this pathway |
WHITFIELD CELL CYCLE G2 M | 216 | 124 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE DN | 841 | 431 | All SZGR 2.0 genes in this pathway |
STAMBOLSKY RESPONSE TO VITAMIN D3 UP | 84 | 48 | All SZGR 2.0 genes in this pathway |
HIRSCH CELLULAR TRANSFORMATION SIGNATURE UP | 242 | 159 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS SENESCENT | 572 | 352 | All SZGR 2.0 genes in this pathway |
HOELZEL NF1 TARGETS DN | 115 | 73 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE MIDDLE | 98 | 56 | All SZGR 2.0 genes in this pathway |
KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
HUANG GATA2 TARGETS UP | 149 | 96 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE VIA P38 COMPLETE | 227 | 151 | All SZGR 2.0 genes in this pathway |
RAO BOUND BY SALL4 ISOFORM B | 517 | 302 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 3 TRANSIENTLY INDUCED BY EGF | 222 | 159 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 156 | 162 | 1A | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
miR-101 | 182 | 188 | 1A | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
miR-139 | 183 | 190 | 1A,m8 | hsa-miR-139brain | UCUACAGUGCACGUGUCU |
miR-144 | 182 | 188 | 1A | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
miR-186 | 461 | 467 | 1A | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
miR-19 | 95 | 102 | 1A,m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-194 | 124 | 130 | m8 | hsa-miR-194 | UGUAACAGCAACUCCAUGUGGA |
miR-23 | 236 | 242 | m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-25/32/92/363/367 | 310 | 317 | 1A,m8 | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
miR-323 | 235 | 242 | 1A,m8 | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
miR-342 | 238 | 244 | 1A | hsa-miR-342brain | UCUCACACAGAAAUCGCACCCGUC |
miR-410 | 75 | 81 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
miR-485-3p | 410 | 416 | 1A | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
miR-494 | 213 | 219 | m8 | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.