Gene Page:TIAL1

Summary?
GeneID 7073
Symbol TIAL1
Synonyms TCBP|TIAR
Description prot TIA1细胞毒性granule-associated RNA绑定ein-like 1
Reference MIM:603413|HGNC:HGNC:11804|HPRD:04563|
Gene type protein-coding
Map location 10q
Pascal p-value 0.179
Sherlock p-value 0.721
Fetal beta 1.455

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0003677 DNA binding NAS -
GO:0003702 RNA polymerase II transcription factor activity TAS 9207209
GO:0003723 RNA binding TAS 1326761
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0006357 regulation of transcription from RNA polymerase II promoter TAS 9207209
GO:0006917 induction of apoptosis TAS 1326761
GO:0008150 biological_process ND -
GO:0006952 defense response TAS 1326761
GO:0006915 apoptosis IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005575 cellular_component ND -
GO:0005764 lysosome TAS 1326761

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER UP 206 111 All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 2HR DN 88 53 All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS DN 459 276 All SZGR 2.0 genes in this pathway
SCHLOSSER MYC TARGETS REPRESSED BY SERUM 159 93 All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 1652 1023 All SZGR 2.0 genes in this pathway
PUJANA BRCA2 PCC NETWORK 423 265 All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442 892 All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS 988 594 All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS 734 436 All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION UP 195 138 All SZGR 2.0 genes in this pathway
GOLDRATH HOMEOSTATIC PROLIFERATION 171 102 All SZGR 2.0 genes in this pathway
YAGI AML RELAPSE PROGNOSIS 35 24 All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP 555 346 All SZGR 2.0 genes in this pathway
THEILGAARD NEUTROPHIL AT SKIN WOUND DN 225 163 All SZGR 2.0 genes in this pathway
MA MYELOID DIFFERENTIATION UP 39 29 All SZGR 2.0 genes in this pathway
YAGI AML SURVIVAL 129 87 All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP 314 201 All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS DN 371 218 All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C2 54 39 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 14HR DN 298 200 All SZGR 2.0 genes in this pathway
ZHANG ANTIVIRAL RESPONSE TO RIBAVIRIN UP 30 21 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 10HR UP 101 69 All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN 434 302 All SZGR 2.0 genes in this pathway
CHENG RESPONSE TO NICKEL ACETATE 45 29 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED 1022 619 All SZGR 2.0 genes in this pathway
BOCHKIS FOXA2 TARGETS 425 261 All SZGR 2.0 genes in this pathway
MATZUK EMBRYONIC GERM CELL 19 16 All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS UP 518 299 All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION 422 277 All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S2 115 74 All SZGR 2.0 genes in this pathway
KYNG WERNER SYNDROM AND NORMAL AGING UP 93 62 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS UP 504 321 All SZGR 2.0 genes in this pathway
DELPUECH FOXO3 TARGETS DN 41 27 All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 AND SATB1 DN 180 116 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-124.1 979 985 1A hsa-miR-124a UUAAGGCACGCGGUGAAUGCCA
miR-141/200a 807 813 m8 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
hsa-miR-200a UAACACUGUCUGGUAACGAUGU
miR-149 562 568 1A hsa-miR-149brain UCUGGCUCCGUGUCUUCACUCC
miR-193 2082 2088 1A hsa-miR-193a AACUGGCCUACAAAGUCCCAG
hsa-miR-193b AACUGGCCCUCAAAGUCCCGCUUU
miR-200bc/429 338 344 m8 hsa-miR-200b UAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200c UAAUACUGCCGGGUAAUGAUGG
hsa-miR-429 UAAUACUGUCUGGUAAAACCGU
miR-203.1 694 701 1A,m8 hsa-miR-203 UGAAAUGUUUAGGACCACUAG
miR-363 1554 1560 1A hsa-miR-363 AUUGCACGGUAUCCAUCUGUAA
miR-381 1148 1154 1A hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU