Gene Page:NKX2-1

概括?
基因 7080
Symbol NKX2-1
Synonyms BCH|BHC|NK-2|NKX2.1|NKX2A|NMTC1|T/EBP|TEBP|TITF1|TTF-1|TTF1
Description NK2 homeobox 1
Reference MIM:600635|HGNC:HGNC:11825|Ensembl:ENSG00000136352|HPRD:02798|Vega:OTTHUMG00000140225
Gene type protein-coding
Map location 14q13
Pascal p-value 0.448
Fetal beta -0.074
eGene Anterior cingulate cortex BA24

Gene in Data Sources
Gene set name Method of gene set Description Info
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 3

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs1951169 14 36965881 NKX2-1 ENSG00000136352.13 2.92827E-6 0.04 24473 gtex_brain_ba24

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
FAM176B 0.77 0.66
VAMP5 0.70 0.56
IFI27 0.70 0.50
METRN 0.70 0.49
IL32 0.69 0.64
GSDMD 0.68 0.56
CLDN5 0.68 0.68
GNG11 0.67 0.54
CRIP1 0.67 0.51
IGFBP7 0.64 0.63
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
WAC -0.61 -0.61
EZH1 -0.60 -0.60
SLC4A1AP -0.58 -0.51
ZNF331 -0.58 -0.59
MTMR15 -0.58 -0.56
PTK2 -0.57 -0.53
HBS1L -0.57 -0.58
PIAS2 -0.56 -0.54
DDHD1 -0.56 -0.52
FBXW11 -0.56 -0.50

Section III. Gene Ontology annotation

Molecular function 去term Evidence Neuro keywords PubMed ID
GO:0003700 transcription factor activity IEA -
GO:0005515 protein binding ISS -
GO:0016563 transcription activator activity ISS -
GO:0016563 transcription activator activity NAS 7711080|7713914
GO:0043565 sequence-specific DNA binding IEA -
Biological process 去term Evidence Neuro keywords PubMed ID
GO:0007420 brain development IEA Brain (GO term level: 7) -
GO:0001764 neuron migration IEA neuron (GO term level: 8) -
GO:0021798 forebrain dorsal/ventral pattern formation IEA Brain (GO term level: 10) -
GO:0009887 organ morphogenesis IEA -
GO:0007492 endoderm development IEA -
GO:0007389 pattern specification process IEA -
GO:0030878 thyroid gland development IEA -
GO:0030324 lung development IEA -
GO:0045944 positive regulation of transcription from RNA polymerase II promoter IEA -
Cellular component 去term Evidence Neuro keywords PubMed ID
GO:0005634 nucleus NAS -
GO:0005654 nucleoplasm ISS -
GO:0005667 transcription factor complex IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PID HNF3B PATHWAY 45 37 All SZGR 2.0 genes in this pathway
LUI THYROID CANCER PAX8 PPARG UP 44 29 All SZGR 2.0 genes in this pathway
TANAKA METHYLATED IN ESOPHAGEAL CARCINOMA 103 58 All SZGR 2.0 genes in this pathway
LUI THYROID CANCER CLUSTER 1 51 33 All SZGR 2.0 genes in this pathway
KIM MYC AMPLIFICATION TARGETS DN 97 51 All SZGR 2.0 genes in this pathway
KIM MYCN AMPLIFICATION TARGETS DN 103 59 All SZGR 2.0 genes in this pathway
LOCKWOOD AMPLIFIED IN LUNG CANCER 214 139 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
HALMOS CEBPA TARGETS DN 46 26 All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK UP 244 151 All SZGR 2.0 genes in this pathway
WELCSH BRCA1 TARGETS UP 198 132 All SZGR 2.0 genes in this pathway
NIELSEN SCHWANNOMA UP 18 16 All SZGR 2.0 genes in this pathway
LOPES METHYLATED IN COLON CANCER UP 27 20 All SZGR 2.0 genes in this pathway
MCCABE BOUND BY HOXC6 469 239 All SZGR 2.0 genes in this pathway
MCCABE HOXC6 TARGETS CANCER UP 31 23 All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN UP 439 257 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
SHEDDEN肺癌好生存A4 196 124 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K27ME3 269 159 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 349 234 All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3 341 243 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590 403 All SZGR 2.0 genes in this pathway
PHESSE TARGETS OF APC AND MBD2 UP 20 14 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY 1725 838 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-23 602 609 1A,m8 hsa-miR-23abrain AUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrain AUCACAUUGCCAGGGAUUACC
miR-338 158 164 1A hsa-miR-338brain UCCAGCAUCAGUGAUUUUGUUGA
mir-495 594 600 m8 hsa-miR-495brain AAACAAACAUGGUGCACUUCUUU