SZGR2 - Beplay体育中心

Summary?

GeneID	7421
Symbol	VDR
Synonyms	NR1I1\|PPP1R163
Description	vitamin D (1,25- dihydroxyvitamin D3) receptor
Reference	MIM:601769\|HGNC:HGNC:12679\|Ensembl:ENSG00000111424\|HPRD:03463\|Vega:OTTHUMG00000169890
Gene type	protein-coding
Map location	12q13.11
Pascal p-value	0.039
Fetal beta	-0.335

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	与精神分裂症Co-occurance关键词:schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0172

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MTMR4	0.86	0.91
NMNAT2	0.85	0.90
KIAA0427	0.84	0.88
KIAA0317	0.84	0.91
L1CAM	0.84	0.90
KIF3C	0.83	0.90
CNNM4	0.83	0.89
RAPGEF1	0.83	0.87
KIAA1409	0.83	0.88
DIP2C	0.83	0.87

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.31	-0.68	-0.81
MT-CO2	-0.65	-0.79
AF347015.27	-0.65	-0.78
FXYD1	-0.65	-0.76
AF347015.8	-0.65	-0.79
MT-CYB	-0.64	-0.77
AF347015.33	-0.64	-0.75
HIGD1B	-0.64	-0.78
CLDN10	-0.63	-0.76
COPZ2	-0.63	-0.73

Section III. Gene Ontology annotation

Molecular function	去的术语	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	IEA		-
GO:0003707	steroid hormone receptor activity	IEA		-
GO:0005515	protein binding	新闻学会		10866662
GO:0008270	zinc ion binding	IEA		-
GO:0008434	vitamin D3 receptor activity	TAS		9070272
GO:0046872	metal ion binding	IEA		-
GO:0043565	sequence-specific DNA binding	IEA		-
生物过程	去的术语	Evidence	Neuro keywords	PubMed ID
GO:0001501	skeletal system development	IEA		-
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0009887	organ morphogenesis	IEA		-
GO:0007165	signal transduction	TAS		2849209
GO:0006816	calcium ion transport	IEA		-
GO:0006874	cellular calcium ion homeostasis	IEA		-
GO:0007275	multicellular organismal development	IEA		-
GO:0016481	negative regulation of transcription	IDA		11891224
GO:0050892	intestinal absorption	IEA		-
Cellular component	去的术语	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
BAG1	RAP46	BCL2-associated athanogene	-	HPRD,BioGRID	10967105
BAZ1B	WBSCR10 \| WBSCR9 \| WSTF	bromodomain adjacent to zinc finger domain, 1B	-	HPRD,BioGRID	12837248
CDK7	CAK1 \| CDKN7 \| MO15 \| STK1 \| p39MO15	cyclin-dependent kinase 7	VDR interacts with hMo15.	BIND	15249124
FOS	AP-1 \| C-FOS	v-fos FBJ murine osteosarcoma viral oncogene homolog	Reconstituted Complex	BioGRID	10330159
GTF2B	TF2B \| TFIIB	general transcription factor IIB	VDR interacts with hTFIIB.	BIND	15249124
JARID1A	KDM5A \| RBBP2 \| RBP2	jumonji, AT rich interactive domain 1A	-	HPRD,BioGRID	11358960
JARID1A	KDM5A \| RBBP2 \| RBP2	jumonji, AT rich interactive domain 1A	Rbp2 interacts with VDR.	BIND	11358960
JUN	AP-1 \| AP1 \| c-Jun	jun oncogene	-	HPRD,BioGRID	10330159
MED1	CRSP1 \| CRSP200 \| DRIP205 \| DRIP230 \| MGC71488 \| PBP \| PPARBP \| PPARGBP \| RB18A \| TRAP220 \| TRIP2	mediator complex subunit 1	Affinity Capture-MS Affinity Capture-Western	BioGRID	10198638\|12837248
MED1	CRSP1 \| CRSP200 \| DRIP205 \| DRIP230 \| MGC71488 \| PBP \| PPARBP \| PPARGBP \| RB18A \| TRAP220 \| TRIP2	mediator complex subunit 1	-	HPRD	9653119
MED12	CAGH45 \| HOPA \| KIAA0192 \| OPA1 \| TNRC11 \| TRAP230	mediator complex subunit 12	Affinity Capture-MS	BioGRID	10198638\|12837248
MED13	ARC250 \| DRIP250 \| HSPC221 \| KIAA0593 \| THRAP1 \| TRAP240	mediator complex subunit 13	Affinity Capture-MS	BioGRID	10198638
MED14	CRSP150 \| CRSP2 \| CSRP \|CXorf4 \| DRIP150 \| EXLM1 \| MGC104513 \| RGR1 \| TRAP170	mediator complex subunit 14	Affinity Capture-MS	BioGRID	10198638
MED16	DRIP92 \| THRAP5 \| TRAP95	mediator complex subunit 16	Affinity Capture-MS	BioGRID	10198638
MED21	SRB7 \| SURB7	mediator complex subunit 21	Affinity Capture-MS	BioGRID	10198638
MED24	ARC100 \| CRSP100 \| CRSP4 \| DRIP100 \| KIAA0130 \| MGC8748 \| THRAP4 \| TRAP100	mediator complex subunit 24	Affinity Capture-MS	BioGRID	10198638\|12837248
MED6	NY-REN-28	mediator complex subunit 6	Affinity Capture-MS	BioGRID	10198638
NCOA1	F-SRC-1 \| KAT13A \| MGC129719 \| MGC129720 \| NCoA-1 \| RIP160 \| SRC-1 \| SRC1 \| bHLHe42	nuclear receptor coactivator 1	-	HPRD,BioGRID	9878542
NCOA1	F-SRC-1 \| KAT13A \| MGC129719 \| MGC129720 \| NCoA-1 \| RIP160 \| SRC-1 \| SRC1 \| bHLHe42	nuclear receptor coactivator 1	VDR interacts with SRC-1.	BIND	15249124
NCOA2	GRIP1 \| KAT13C \| MGC138808 \| NCoA-2 \| TIF2	nuclear receptor coactivator 2	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	10748178\|12612084 \|12837248
NCOA2	GRIP1 \| KAT13C \| MGC138808 \| NCoA-2 \| TIF2	nuclear receptor coactivator 2	GRIP1 interacts with VDR. This interaction was modeled on a demonstrated interaction between mouse GRIP1 and human VDR.	BIND	9920895
NCOA3	ACTR \| AIB-1 \| AIB1 \| CAGH16 \| CTG26 \| KAT13B \| MGC141848 \| RAC3 \| SRC3 \| TNRC14 \| TNRC16 \| TRAM-1 \| pCIP	nuclear receptor coactivator 3	ACTR interacts with VDR.	BIND	9267036
NCOR1	KIAA1047 \| MGC104216 \| N-CoR \| TRAC1 \| hCIT529I10 \| hN-CoR	nuclear receptor co-repressor 1	Reconstituted Complex	BioGRID	12460926
NCOR2	CTG26 \| SMRT \| SMRTE \| SMRTE-tau \| TNRC14 \| TRAC-1 \| TRAC1	nuclear receptor co-repressor 2	Reconstituted Complex	BioGRID	12460926
POU1F1	GHF-1 \| PIT1 \| Pit-1	POU class 1 homeobox 1	Reconstituted Complex	BioGRID	11891224
POU2F1	OCT1 \| OTF1	POU class 2 homeobox 1	Reconstituted Complex	BioGRID	10383413
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	Reconstituted Complex	BioGRID	11358960
RUNX1	AML1 \| AML1-EVI-1 \| AMLCR1 \| CBFA2 \| EVI-1 \| PEBP2aB	runt-related transcription factor 1	Affinity Capture-Western Reconstituted Complex	BioGRID	12460926
RUNX1T1	AML1T1 \| CBFA2T1 \| CDR \| ETO \| MGC2796 \| MTG8 \| MTG8b \| ZMYND2	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	Affinity Capture-Western Reconstituted Complex	BioGRID	12460926
RXRA	FLJ00280 \| FLJ00318 \| FLJ16020 \| FLJ16733 \| MGC102720 \| NR2B1	retinoid X receptor, alpha	Reconstituted Complex Two-hybrid	BioGRID	9632709
RXRA	FLJ00280 \| FLJ00318 \| FLJ16020 \| FLJ16733 \| MGC102720 \| NR2B1	retinoid X receptor, alpha	VDR interacts with RXRA (RXRalpha) to form a heterodimer.	BIND	15829977
SMAD3	DKFZp586N0721 \| DKFZp686J10186 \| HSPC193 \| HsT17436 \| JV15-2 \| MADH3 \| MGC60396	SMAD家庭成员3	VDR interacts with Smad3. This interaction was modeled on a demonstrated interaction between VDR and Smad3 from unspecified sources.	BIND	11278756
SMARCA4	BAF190 \| BRG1 \| FLJ39786 \| SNF2 \| SNF2-BETA \| SNF2L4 \| SNF2LB \| SWI2 \| hSNF2b	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	Affinity Capture-Western	BioGRID	12837248
SNW1	Bx42 \| MGC119379 \| NCOA-62 \| PRPF45 \| Prp45 \| SKIIP \| SKIP	SNW domain containing 1	-	HPRD,BioGRID	9632709\|12529369
STAT1	DKFZp686B04100 \| ISGF-3 \| STAT91	signal transducer and activator of transcription 1, 91kDa	-	HPRD,BioGRID	11909970
TDG	-	thymine-DNA glycosylase	-	HPRD,BioGRID	12874288
THRAP3	FLJ22082 \| MGC133082 \| MGC133083 \| TRAP150	thyroid hormone receptor associated protein 3	Affinity Capture-MS	BioGRID	10198638
TRIM24	PTC6 \| RNF82 \| TF1A \| TIF1 \| TIF1A \| TIF1ALPHA \| hTIF1	tripartite motif-containing 24	-	HPRD	9115274
TRRAP	FLJ10671 \| PAF350/400 \| PAF400 \| STAF40 \| TR-AP \| Tra1	transformation/transcription domain-associated protein	Affinity Capture-MS	BioGRID	12837248
VDR	NR1I1	vitamin D (1,25- dihydroxyvitamin D3) receptor	-	HPRD,BioGRID	11980721
ZBTB16	PLZF \| ZNF145	zinc finger and BTB domain containing 16	-	HPRD,BioGRID	11719366\|12460926 \|14521715

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID SMAD2 3NUCLEAR PATHWAY	82	63	All SZGR 2.0 genes in this pathway
PID P53 DOWNSTREAM PATHWAY	137	94	All SZGR 2.0 genes in this pathway
PID RXR VDR PATHWAY	26	24	All SZGR 2.0 genes in this pathway
PID RETINOIC ACID PATHWAY	30	23	All SZGR 2.0 genes in this pathway
PID DELTA NP63 PATHWAY	47	34	All SZGR 2.0 genes in this pathway
PID TAP63 PATHWAY	54	40	All SZGR 2.0 genes in this pathway
REACTOME GENERIC TRANSCRIPTION PATHWAY	352	181	All SZGR 2.0 genes in this pathway
REACTOME NUCLEAR RECEPTOR TRANSCRIPTION PATHWAY	49	36	All SZGR 2.0 genes in this pathway
DOANE RESPONSE TO ANDROGEN DN	241	146	All SZGR 2.0 genes in this pathway
GAL LEUKEMIC STEM CELL DN	244	153	All SZGR 2.0 genes in this pathway
RODRIGUES NTN1 TARGETS DN	158	102	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN	536	332	All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN	781	465	All SZGR 2.0 genes in this pathway
LIU CDX2 TARGETS UP	36	22	All SZGR 2.0 genes in this pathway
LANDIS BREAST CANCER PROGRESSION UP	44	27	All SZGR 2.0 genes in this pathway
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS CDC25 DN	51	35	All SZGR 2.0 genes in this pathway
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS DN	142	95	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS G UP	238	135	All SZGR 2.0 genes in this pathway
LANDIS ERBB2 BREAST TUMORS 324 UP	150	93	All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA DN	394	258	All SZGR 2.0 genes in this pathway
SAENZ DETOX PATHWAY AND CARCINOGENESIS DN	13	11	All SZGR 2.0 genes in this pathway
BEGUM TARGETS OF PAX3 FOXO1 FUSION DN	45	34	All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION 6HR	40	23	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS	355	243	All SZGR 2.0 genes in this pathway
PEREZ TP53 AND TP63 TARGETS	205	145	All SZGR 2.0 genes in this pathway
KOMMAGANI TP63 GAMMA TARGETS	9	7	All SZGR 2.0 genes in this pathway
SCHLESINGER METHYLATED DE NOVO IN CANCER	88	64	All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX	795	478	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS DN	357	212	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 DN	464	276	All SZGR 2.0 genes in this pathway
CERVERA SDHB TARGETS 1 UP	118	66	All SZGR 2.0 genes in this pathway
OKUMURA INFLAMMATORY RESPONSE LPS	183	115	All SZGR 2.0 genes in this pathway
KLEIN PRIMARY EFFUSION LYMPHOMA UP	51	29	All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS DN	366	238	All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION	475	313	All SZGR 2.0 genes in this pathway
THEILGAARD NEUTROPHIL AT SKIN WOUND UP	77	52	All SZGR 2.0 genes in this pathway
MOREAUX MULTIPLE MYELOMA BY TACI UP	412	249	All SZGR 2.0 genes in this pathway
REN ALVEOLAR RHABDOMYOSARCOMA DN	408	274	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL LONG TERM	302	191	All SZGR 2.0 genes in this pathway
NATSUME RESPONSE TO INTERFERON BETA DN	52	33	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN	504	323	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 8HR DN	47	31	All SZGR 2.0 genes in this pathway
GERHOLD ADIPOGENESIS DN	64	44	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 2	72	52	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR DN	178	121	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS PEAK AT 8HR	39	31	All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER P2	79	55	All SZGR 2.0 genes in this pathway
STEIN ESRRA TARGETS DN	105	63	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN	543	317	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
OSADA ASCL1 TARGETS UP	46	30	All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN UP	439	257	All SZGR 2.0 genes in this pathway
BOCHKIS FOXA2 TARGETS	425	261	All SZGR 2.0 genes in this pathway
MATZUK STEROIDOGENESIS	7	6	All SZGR 2.0 genes in this pathway
RAY TUMORIGENESIS BY ERBB2 CDC25A DN	159	105	All SZGR 2.0 genes in this pathway
ZHOU PANCREATIC ENDOCRINE PROGENITOR	14	11	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO CSF2RB AND IL4 UP	338	225	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF UP	418	282	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 DN	245	150	All SZGR 2.0 genes in this pathway
AGUIRRE PANCREATIC CANCER COPY NUMBER DN	238	145	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 5	33	24	All SZGR 2.0 genes in this pathway
YAGI AML WITH T 8 21 TRANSLOCATION	368	247	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2	491	319	All SZGR 2.0 genes in this pathway
LI PROSTATE CANCER EPIGENETIC	30	22	All SZGR 2.0 genes in this pathway
STEIN ESRRA TARGETS	535	325	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3	341	243	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA MESENCHYMAL	216	130	All SZGR 2.0 genes in this pathway
KANG AR TARGETS UP	17	10	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 DN	448	282	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
WANG THOC1 TARGETS DN	20	14	All SZGR 2.0 genes in this pathway
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7	403	240	All SZGR 2.0 genes in this pathway
PEDERSEN TARGETS OF 611CTF ISOFORM OF ERBB2	76	45	All SZGR 2.0 genes in this pathway
ROLEF GLIS3 TARGETS	37	29	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN	784	464	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE VIA P38 PARTIAL	160	106	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE NOT VIA P38	337	236	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-125/351	362	369	1A,m8	hsa-miR-125b^brain	UCCCUGAGACCCUAACUUGUGA
miR-125/351	362	369	1A,m8	hsa-miR-125a^brain	UCCCUGAGACCCUUUAACCUGUG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.

Gene Page:VDR