Gene Page:WNT2B

Summary?
GeneID 7482
Symbol WNT2B
Synonyms WNT13
Description wingless-type MMTV integration site family member 2B
Reference MIM:601968|HGNC:HGNC:12781|Ensembl:ENSG00000134245|HPRD:03574|Vega:OTTHUMG00000011157
Gene type protein-coding
Map location 1p13
Pascal p-value 2.915E-4
Fetal beta 0.721
DMG 1 (# studies)
eGene Cortex
Frontal Cortex BA9
元

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I Genome scan meta-analysis Psr: 0.0235
Literature High-throughput literature-search 与Schi Co-occurancezophrenia keywords: schizophrenia,schizophrenic,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg19722720 1 113051353 WNT2B 3.13E-5 -0.34 0.019 DMG:Wockner_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
ELOVL2 0.79 0.79
ADAM17 0.79 0.75
UGDH 0.79 0.74
ARFIP1 0.78 0.74
EPB41L5 0.78 0.81
RP2 0.78 0.76
FSTL1 0.78 0.76
RDX 0.77 0.74
PGGT1B 0.77 0.73
PKN2 0.77 0.76
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
CA4 -0.48 -0.48
MYL3 -0.47 -0.48
IFI27 -0.44 -0.49
AF347015.21 -0.44 -0.47
C2orf82 -0.43 -0.55
FXYD1 -0.43 -0.46
AC018755.7 -0.43 -0.49
MT-CO2 -0.43 -0.48
CXCL14 -0.43 -0.47
CA11 -0.42 -0.46

Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0004871 signal transducer activity IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007223 Wnt receptor signaling pathway, calcium modulating pathway IEA -
GO:0009653 anatomical structure morphogenesis TAS 8761309
GO:0007275 multicellular organismal development TAS 8761309
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005576 extracellular region IEA -
GO:0005578 蛋白质的细胞外基质 IEA -
GO:0005615 extracellular space TAS 8761309

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG WNT SIGNALING PATHWAY 151 112 All SZGR 2.0 genes in this pathway
KEGG HEDGEHOG SIGNALING PATHWAY 56 42 All SZGR 2.0 genes in this pathway
KEGG MELANOGENESIS 102 80 All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER 328 259 All SZGR 2.0 genes in this pathway
KEGG BASAL CELL CARCINOMA 55 44 All SZGR 2.0 genes in this pathway
WNT SIGNALING 89 71 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR 920 449 All SZGR 2.0 genes in this pathway
REACTOME CLASS B 2 SECRETIN FAMILY RECEPTORS 88 58 All SZGR 2.0 genes in this pathway
REACTOME GPCR LIGAND BINDING 408 246 All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX 795 478 All SZGR 2.0 genes in this pathway
VERRECCHIA RESPONSE TO TGFB1 C2 25 18 All SZGR 2.0 genes in this pathway
VERRECCHIA EARLY RESPONSE TO TGFB1 58 43 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED 1229 713 All SZGR 2.0 genes in this pathway
WALLACE PROSTATE CANCER RACE UP 299 167 All SZGR 2.0 genes in this pathway
BONCI TARGETS OF MIR15A AND MIR16 1 91 75 All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS UP 165 118 All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS DN 138 92 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K27ME3 269 159 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 491 319 All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3 435 318 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839 928 All SZGR 2.0 genes in this pathway
NABA SECRETED FACTORS 344 197 All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED 753 411 All SZGR 2.0 genes in this pathway
NABA MATRISOME 1028 559 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-130/301 281 288 1A,m8 hsa-miR-130abrain CAGUGCAAUGUUAAAAGGGCAU
hsa-miR-301 CAGUGCAAUAGUAUUGUCAAAGC
hsa-miR-130bbrain CAGUGCAAUGAUGAAAGGGCAU
hsa-miR-454-3p UAGUGCAAUAUUGCUUAUAGGGUUU
miR-15/16/195/424/497 96 102 1A hsa-miR-15abrain UAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brain UAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrain UAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZ UAGCAGCACAGAAAUAUUGGC
hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497 CAGCAGCACACUGUGGUUUGU
miR-218 49 56 1A,m8 hsa-miR-218brain UUGUGCUUGAUCUAACCAUGU
miR-503 96 102 1A hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG