Gene Page:CNBP
Summary?
GeneID | 7555 |
Symbol | CNBP |
Synonyms | CNBP1|DM2|PROMM|RNF163|ZCCHC22|ZNF9 |
Description | CCHC-type zinc finger, nucleic acid binding protein |
Reference | MIM:116955|HGNC:HGNC:13164|HPRD:00311| |
Gene type | protein-coding |
Map location | 3q21 |
Pascal p-value | 0.009 |
Sherlock p-value | 0.201 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0324 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/CNBP_DE_GTEx.png)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26页ostconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003676 | nucleic acid binding | IEA | - | |
GO:0003700 | transcription factor activity | TAS | 2562787 | |
GO:0005515 | protein binding | 新闻学会 | 17353931 | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0006355 | regulation of transcription, DNA-dependent | TAS | 2562787 | |
GO:0006350 | transcription | IEA | - | |
GO:0006695 | cholesterol biosynthetic process | TAS | 2562787 | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005783 | endoplasmic reticulum | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
APOBEC3C | APOBEC1L | ARDC2 | ARDC4 | ARP5 | MGC19485 | PBI | bK150C2.3 | apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C | Affinity Capture-MS | BioGRID | 17353931 |
BXDC2 | BRIX | FLJ11100 | brix domain containing 2 | Affinity Capture-MS | BioGRID | 17353931 |
DAP3 | DAP-3 | DKFZp686G12159 | MGC126058 | MGC126059 | MRP-S29 | MRPS29 | bMRP-10 | death associated protein 3 | Affinity Capture-MS | BioGRID | 17353931 |
DHX9 | DDX9 | LKP | NDHII | RHA | DEAH (Asp-Glu-Ala-His) box polypeptide 9 | Affinity Capture-MS | BioGRID | 17353931 |
EBNA1BP2 | EBP2 | NOBP | P40 | EBNA1 binding protein 2 | Affinity Capture-MS | BioGRID | 17353931 |
ERH | DROER | FLJ27340 | enhancer of rudimentary homolog (Drosophila) | Affinity Capture-MS | BioGRID | 17353931 |
HNRNPA3 | 2610510D13Rik | D10S102 | FBRNP | HNRPA3 | MGC138232 | MGC142030 | heterogeneous nuclear ribonucleoprotein A3 | Affinity Capture-MS | BioGRID | 17353931 |
HNRNPAB | ABBP1 | FLJ40338 | HNRPAB | heterogeneous nuclear ribonucleoprotein A/B | Affinity Capture-MS | BioGRID | 17353931 |
HNRNPC | C1 | C2 | HNRNP | HNRPC | MGC104306 | MGC105117 | MGC117353 | MGC131677 | SNRPC | heterogeneous nuclear ribonucleoprotein C (C1/C2) | Affinity Capture-MS | BioGRID | 17353931 |
HNRNPR | FLJ25714 | HNRPR | hnRNP-R | heterogeneous nuclear ribonucleoprotein R | Affinity Capture-MS | BioGRID | 17353931 |
HNRNPUL1 | E1B-AP5 | E1BAP5 | FLJ12944 | HNRPUL1 | heterogeneous nuclear ribonucleoprotein U-like 1 | Affinity Capture-MS | BioGRID | 17353931 |
IGF2BP1 | CRD-BP | CRDBP | IMP-1 | IMP1 | VICKZ1 | ZBP1 | insulin-like growth factor 2 mRNA binding protein 1 | Affinity Capture-MS | BioGRID | 17353931 |
IGF2BP3 | DKFZp686F1078 | IMP-3 | IMP3 | KOC1 | VICKZ3 | insulin-like growth factor 2 mRNA binding protein 3 | Affinity Capture-MS | BioGRID | 17353931 |
PURA | PUR-ALPHA | PUR1 | PURALPHA | purine-rich element binding protein A | Affinity Capture-MS | BioGRID | 17353931 |
RBMX | HNRPG | RBMXP1 | RBMXRT | RNMX | hnRNP-G | RNA binding motif protein, X-linked | Affinity Capture-MS | BioGRID | 17353931 |
RPA3 | REPA3 | replication protein A3, 14kDa | Affinity Capture-MS | BioGRID | 17353931 |
RPL23A | FLJ27455 | MDA20 | ribosomal protein L23a | Affinity Capture-MS | BioGRID | 17353931 |
RPL3 | MGC104284 | TARBP-B | ribosomal protein L3 | Affinity Capture-MS | BioGRID | 17353931 |
RPL31 | MGC88191 | ribosomal protein L31 | Affinity Capture-MS | BioGRID | 17353931 |
RPL34 | MGC111005 | ribosomal protein L34 | Affinity Capture-MS | BioGRID | 17353931 |
RPL35A | - | ribosomal protein L35a | Affinity Capture-MS | BioGRID | 17353931 |
RPL36 | DKFZp566B023 | ribosomal protein L36 | Affinity Capture-MS | BioGRID | 17353931 |
RPS16 | - | ribosomal protein S16 | Affinity Capture-MS | BioGRID | 17353931 |
RPS19 | DBA | ribosomal protein S19 | Affinity Capture-MS | BioGRID | 17353931 |
RPS3A | FTE1 | MFTL | MGC23240 | ribosomal protein S3A | Affinity Capture-MS | BioGRID | 17353931 |
RSL1D1 | CSIG | DKFZP564M182 | L12 | MGC138433 | MGC142259 | PBK1 | ribosomal L1 domain containing 1 | Affinity Capture-MS | BioGRID | 17353931 |
SYNCRIP | GRY-RBP | HNRPQ1 | NSAP1 | RP1-3J17.2 | dJ3J17.2 | hnRNP-Q | pp68 | synaptotagmin binding, cytoplasmic RNA interacting protein | Affinity Capture-MS | BioGRID | 17353931 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
RHEIN ALL GLUCOCORTICOID THERAPY DN | 362 | 238 | All SZGR 2.0 genes in this pathway |
SCHLOSSER MYC TARGETS REPRESSED BY SERUM | 159 | 93 | All SZGR 2.0 genes in this pathway |
SIMBULAN UV RESPONSE NORMAL DN | 33 | 27 | All SZGR 2.0 genes in this pathway |
HATADA METHYLATED IN LUNG CANCER UP | 390 | 236 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
PUJANA CHEK2 PCC NETWORK | 779 | 480 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
CAFFAREL RESPONSE TO THC 24HR 5 UP | 34 | 23 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
SHEN SMARCA2 TARGETS UP | 424 | 268 | All SZGR 2.0 genes in this pathway |
IIZUKA LIVER CANCER PROGRESSION L0 L1 UP | 17 | 12 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL AND BRAIN QTL TRANS | 185 | 114 | All SZGR 2.0 genes in this pathway |
ZUCCHI METASTASIS UP | 43 | 24 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
PARK HSC AND MULTIPOTENT PROGENITORS | 50 | 33 | All SZGR 2.0 genes in this pathway |
SESTO RESPONSE TO UV C0 | 107 | 72 | All SZGR 2.0 genes in this pathway |
GRADE COLON AND RECTAL CANCER UP | 285 | 167 | All SZGR 2.0 genes in this pathway |
WANG TUMOR INVASIVENESS DN | 210 | 128 | All SZGR 2.0 genes in this pathway |
GRESHOCK CANCER COPY NUMBER UP | 323 | 240 | All SZGR 2.0 genes in this pathway |
ROME INSULIN TARGETS IN MUSCLE UP | 442 | 263 | All SZGR 2.0 genes in this pathway |
BAE BRCA1 TARGETS UP | 75 | 47 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE DN | 841 | 431 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-129-5p | 174 | 180 | 1A | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
miR-193 | 102 | 108 | m8 | hsa-miR-193a | AACUGGCCUACAAAGUCCCAG |
hsa-miR-193b | AACUGGCCCUCAAAGUCCCGCUUU | ||||
miR-320 | 110 | 116 | 1A | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
miR-326 | 643 | 649 | m8 | hsa-miR-326 | CCUCUGGGCCCUUCCUCCAG |
miR-330 | 217 | 223 | m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
miR-369-3p | 42 | 48 | m8 | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
miR-378 | 689 | 695 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
miR-381 | 737 | 743 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
miR-494 | 764 | 770 | 1A | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
miR-495 | 220 | 226 | 1A | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |