Gene Page:CACNA1E

Summary?
GeneID 777
Symbol CACNA1E
Synonyms BII|CACH6|CACNL1A6|Cav2.3
Description calcium voltage-gated channel subunit alpha1 E
Reference MIM:601013|HGNC:HGNC:1392|Ensembl:ENSG00000198216|HPRD:03006|Vega:OTTHUMG00000037301
Gene type protein-coding
Map location 1q25.3
Fetal beta 0.256
eGene 元
Support CANABINOID
DOPAMINE
EXCITABILITY
METABOTROPIC GLUTAMATE RECEPTOR
SEROTONIN
G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS
G2Cdb.humanPSD
G2Cdb.humanPSP
CompositeSet
Darnell FMRP targets
Potential synaptic genes

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations 点击neuro-related关键words: 1

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception我们eks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
ATP13A3 0.89 0.92
PCYOX1 0.88 0.93
ZBTB38 0.88 0.93
ARHGAP20 0.88 0.94
FAM160B1 0.86 0.92
EDEM3 0.86 0.91
GNAQ 0.86 0.91
CAMSAP1L1 0.85 0.92
NRXN1 0.85 0.92
SLC41A2 0.84 0.90
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
C11orf67 -0.59 -0.68
HSD17B14 -0.59 -0.69
FXYD1 -0.58 -0.68
EIF4EBP3 -0.58 -0.68
ACSF2 -0.57 -0.68
TLCD1 -0.57 -0.67
AF347015.31 -0.56 -0.67
HIGD1B -0.56 -0.70
MT-CO2 -0.56 -0.68
RAB34 -0.56 -0.69

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005509 calcium ion binding IEA -
GO:0005244 voltage-gated ion channel activity IEA -
GO:0005245 voltage-gated calcium channel activity TAS 8071363
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007268 synaptic transmission TAS neuron, Synap, Neurotransmitter (GO term level: 6) 8071363
GO:0006816 calcium ion transport IEA -
GO:0006811 ion transport IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0016021 integral to membrane IEA -
GO:0005886 plasma membrane EXP 8825650
GO:0005891 voltage-gated calcium channel complex TAS 8071363

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG MAPK SIGNALING PATHWAY 267 205 All SZGR 2.0 genes in this pathway
KEGG CALCIUM SIGNALING PATHWAY 178 134 All SZGR 2.0 genes in this pathway
KEGG TYPE II DIABETES MELLITUS 47 41 All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE UP 530 342 All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL DN 186 107 All SZGR 2.0 genes in this pathway
DARWICHE SKIN TUMOR PROMOTER UP 142 96 All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK LOW UP 162 104 All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK HIGH UP 147 101 All SZGR 2.0 genes in this pathway
DARWICHE SQUAMOUS CELL CARCINOMA UP 146 104 All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN 712 443 All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM4 261 153 All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 1652 1023 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 16HR DN 86 62 All SZGR 2.0 genes in this pathway
RAMASWAMY METASTASIS DN 61 47 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 14HR DN 298 200 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN 504 323 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 12HR DN 101 64 All SZGR 2.0 genes in this pathway
MARZEC IL2 SIGNALING DN 36 24 All SZGR 2.0 genes in this pathway
MIKKELSEN IPS WITH HCP H3K27ME3 102 76 All SZGR 2.0 genes in this pathway
MIKKELSEN ES HCP WITH H3K27ME3 41 30 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590 403 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 30MIN DN 150 99 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 1HR DN 222 147 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 4HR DN 254 158 All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP 397 206 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
let-7/98 1368 1374 1A hsa-let-7abrain UGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrain UGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrain UGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrain AGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrain UGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrain UGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brain UGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZ UGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrain UGAGGUAGUAGUUUGUGCUGU
miR-135 640 647 1A,m8 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUG
miR-138 440 446 m8 hsa-miR-138brain AGCUGGUGUUGUGAAUC
miR-143 493 499 1A hsa-miR-143brain UGAGAUGAAGCACUGUAGCUCA
miR-182 2259 2265 1A hsa-miR-182 UUUGGCAAUGGUAGAACUCACA
miR-183 207 213 1A hsa-miR-183 UAUGGCACUGGUAGAAUUCACUG
miR-30-3p 1930 1936 1A hsa-miR-30a-3p CUUUCAGUCGGAUGUUUGCAGC
hsa-miR-30e-3p CUUUCAGUCGGAUGUUUACAGC
miR-320 2321 2327 m8 hsa-miR-320 AAAAGCUGGGUUGAGAGGGCGAA
miR-326 1500 1506 m8 hsa-miR-326 CCUCUGGGCCCUUCCUCCAG
miR-96 2259 2265 1A hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC