Gene Page:OTUB2
Summary?
GeneID | 78990 |
Symbol | OTUB2 |
Synonyms | C14orf137|OTB2|OTU2 |
Description | OTU deubiquitinase, ubiquitin aldehyde binding 2 |
Reference | MIM:608338|HGNC:HGNC:20351|Ensembl:ENSG00000089723|HPRD:07620|Vega:OTTHUMG00000171300 |
Gene type | protein-coding |
Map location | 14q32.12 |
Pascal p-value | 0.022 |
eGene | Cortex |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
Expression | Meta-analysis of gene expression | Pvalue: 1.416 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
KLHL17 | 0.92 | 0.88 |
TRABD | 0.91 | 0.90 |
CAPN10 | 0.91 | 0.88 |
FBXL6 | 0.90 | 0.87 |
TUBGCP6 | 0.90 | 0.92 |
TAF1C | 0.90 | 0.87 |
ARRDC1 | 0.90 | 0.89 |
GIGYF1 | 0.90 | 0.87 |
WDR85 | 0.90 | 0.87 |
ABCC10 | 0.90 | 0.90 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.31 | -0.64 | -0.67 |
AF347015.27 | -0.63 | -0.66 |
MT-CO2 | -0.61 | -0.65 |
AF347015.21 | -0.60 | -0.73 |
MT-CYB | -0.60 | -0.62 |
AF347015.8 | -0.59 | -0.64 |
AF347015.33 | -0.58 | -0.60 |
AF347015.15 | -0.57 | -0.60 |
COPZ2 | -0.56 | -0.59 |
AF347015.2 | -0.55 | -0.61 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0008234 | cysteine-type peptidase activity | IEA | - | |
GO:0008233 | peptidase activity | IEA | - | |
GO:0016289 | CoA hydrolase activity | IDA | 12704427 | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0006511 | ubiquitin-dependent protein catabolic process | IEA | - | |
GO:0006519 | cellular amino acid and derivative metabolic process | IDA | 12704427 | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005575 | cellular_component | ND | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LIVE DN | 384 | 220 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 TARGETS UP | 457 | 269 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 AND HDAC2 TARGETS UP | 238 | 144 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE FIMA DN | 284 | 156 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
MORI EMU MYC LYMPHOMA BY ONSET TIME UP | 110 | 69 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS MATURE CELL | 293 | 160 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS UP | 388 | 234 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA C D UP | 139 | 95 | All SZGR 2.0 genes in this pathway |
ZHANG TLX TARGETS 36HR UP | 221 | 150 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS | 535 | 325 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP | 271 | 165 | All SZGR 2.0 genes in this pathway |
FOSTER KDM1A TARGETS DN | 211 | 119 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-133 | 785 | 791 | m8 | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
miR-224 | 422 | 429 | 1A,m8 | hsa-miR-224 | CAAGUCACUAGUGGUUCCGUUUA |
miR-23 | 505 | 511 | m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-323 | 505 | 511 | 1A | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.