Gene Page:OTUB2

Summary?
GeneID 78990
Symbol OTUB2
Synonyms C14orf137|OTB2|OTU2
Description OTU deubiquitinase, ubiquitin aldehyde binding 2
Reference MIM:608338|HGNC:HGNC:20351|Ensembl:ENSG00000089723|HPRD:07620|Vega:OTTHUMG00000171300
Gene type protein-coding
Map location 14q32.12
Pascal p-value 0.022
eGene Cortex

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
Expression Meta-analysis of gene expression Pvalue: 1.416

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
KLHL17 0.92 0.88
TRABD 0.91 0.90
CAPN10 0.91 0.88
FBXL6 0.90 0.87
TUBGCP6 0.90 0.92
TAF1C 0.90 0.87
ARRDC1 0.90 0.89
GIGYF1 0.90 0.87
WDR85 0.90 0.87
ABCC10 0.90 0.90
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.31 -0.64 -0.67
AF347015.27 -0.63 -0.66
MT-CO2 -0.61 -0.65
AF347015.21 -0.60 -0.73
MT-CYB -0.60 -0.62
AF347015.8 -0.59 -0.64
AF347015.33 -0.58 -0.60
AF347015.15 -0.57 -0.60
COPZ2 -0.56 -0.59
AF347015.2 -0.55 -0.61

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0008234 cysteine-type peptidase activity IEA -
GO:0008233 peptidase activity IEA -
GO:0016289 CoA hydrolase activity IDA 12704427
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006511 ubiquitin-dependent protein catabolic process IEA -
GO:0006519 cellular amino acid and derivative metabolic process IDA 12704427
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005575 cellular_component ND -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PARENT MTOR SIGNALING UP 567 375 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE DN 384 220 All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS UP 457 269 All SZGR 2.0 genes in this pathway
SENESE HDAC1 AND HDAC2 TARGETS UP 238 144 All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP 501 327 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA UP 544 308 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA DN 284 156 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP 1142 669 All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215 893 528 All SZGR 2.0 genes in this pathway
MORI EMU MYC LYMPHOMA BY ONSET TIME UP 110 69 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS MATURE CELL 293 160 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 720 440 All SZGR 2.0 genes in this pathway
STEIN ESRRA TARGETS UP 388 234 All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C D UP 139 95 All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR UP 221 150 All SZGR 2.0 genes in this pathway
STEIN ESRRA TARGETS 535 325 All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP 745 475 All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP 271 165 All SZGR 2.0 genes in this pathway
FOSTER KDM1A TARGETS DN 211 119 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-133 785 791 m8 hsa-miR-133a UUGGUCCCCUUCAACCAGCUGU
hsa-miR-133b UUGGUCCCCUUCAACCAGCUA
miR-224 422 429 1A,m8 hsa-miR-224 CAAGUCACUAGUGGUUCCGUUUA
miR-23 505 511 m8 hsa-miR-23abrain AUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrain AUCACAUUGCCAGGGAUUACC
miR-323 505 511 1A hsa-miR-323brain GCACAUUACACGGUCGACCUCU