Gene Page:AHNAK

Summary?
GeneID 79026
Symbol AHNAK
Synonyms AHNAKRS
Description AHNAK nucleoprotein
Reference MIM:103390|HGNC:HGNC:347|Ensembl:ENSG00000124942|HPRD:14684|Vega:OTTHUMG00000167558
Gene type protein-coding
Map location 11q12.2
Pascal p-value 0.564
Fetal beta -0.412
DMG 3 (# studies)
eGene Myers' cis & trans
Support CompositeSet
Ascano FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Nishioka_2013 Genome-wide DNA methylation analysis The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. 3
DMG:vanEijk_2014 Genome-wide DNA methylation analysis This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). 3
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 3
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg08740862 11 62314417 AHNAK 9.43E-6 -0.326 0.013 DMG:Wockner_2014
cg19902569 11 62313929 AHNAK -0.027 0.57 DMG:Nishioka_2013
cg12640109 11 62104720 AHNAK 4.63E-4 5.417 DMG:vanEijk_2014

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs13023481 chr2 213839772 AHNAK 79026 0.1 trans
rs10994209 chr10 61877705 AHNAK 79026 0.06 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AL109918.1 0.77 0.46
AC106886.1 0.74 0.52
AL137849.1 0.73 0.47
PGAM1 0.73 0.54
FKBP1C 0.72 0.53
CDC26 0.70 0.52
AC073063.1 0.69 0.63
RPL36A 0.69 0.76
AC133555.1 0.69 0.56
AC103988.2 0.68 0.42
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.8 -0.41 -0.63
AF347015.26 -0.41 -0.63
AF347015.15 -0.40 -0.62
AF347015.2 -0.40 -0.62
AF347015.31 -0.40 -0.60
MT-CO2 -0.39 -0.60
AF347015.27 -0.38 -0.60
MT-CYB -0.38 -0.59
AF347015.18 -0.36 -0.62
MT-ATP8 -0.36 -0.57

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005515 protein binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007399 nervous system development NAS neurite (GO term level: 5) -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus NAS 1608957

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN 169 118 All SZGR 2.0 genes in this pathway
DOANE RESPONSE TO ANDROGEN UP 184 125 All SZGR 2.0 genes in this pathway
GRABARCZYK BCL11B TARGETS UP 81 40 All SZGR 2.0 genes in this pathway
RODRIGUES NTN1 TARGETS DN 158 102 All SZGR 2.0 genes in this pathway
JAEGER METASTASIS DN 258 141 All SZGR 2.0 genes in this pathway
RHEIN ALL GLUCOCORTICOID THERAPY UP 78 41 All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS DN 260 143 All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN 536 332 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821 933 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP 722 443 All SZGR 2.0 genes in this pathway
LANDIS BREAST CANCER PROGRESSION DN 70 43 All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 3 DN 229 142 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP 1142 669 All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP 612 367 All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS G DN 35 18 All SZGR 2.0 genes in this pathway
LANDIS ERBB2 BREAST TUMORS 324 DN 149 93 All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER BASAL VS LULMINAL 330 215 All SZGR 2.0 genes in this pathway
WANG HCP PROSTATE CANCER 111 69 All SZGR 2.0 genes in this pathway
SIMBULAN UV RESPONSE NORMAL DN 33 27 All SZGR 2.0 genes in this pathway
SIMBULAN UV RESPONSE IMMORTALIZED DN 31 26 All SZGR 2.0 genes in this pathway
金正日MYCL1放大目标S DN 20 12 All SZGR 2.0 genes in this pathway
YANG BREAST CANCER ESR1 UP 36 22 All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN 848 527 All SZGR 2.0 genes in this pathway
FERREIRA EWINGS SARCOMA UNSTABLE VS STABLE DN 98 59 All SZGR 2.0 genes in this pathway
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN 382 224 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN 514 330 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 12HR UP 116 79 All SZGR 2.0 genes in this pathway
BASSO B LYMPHOCYTE NETWORK 143 96 All SZGR 2.0 genes in this pathway
GRANDVAUX IRF3 TARGETS UP 15 12 All SZGR 2.0 genes in this pathway
FLECHNER PBL KIDNEY TRANSPLANT OK VS DONOR UP 151 100 All SZGR 2.0 genes in this pathway
ABBUD LIF SIGNALING 1 DN 26 17 All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION 475 313 All SZGR 2.0 genes in this pathway
LI WILMS TUMOR VS FETAL KIDNEY 1 UP 182 119 All SZGR 2.0 genes in this pathway
YAGI AML FAB MARKERS 191 131 All SZGR 2.0 genes in this pathway
HENDRICKS SMARCA4 TARGETS UP 56 35 All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN 830 547 All SZGR 2.0 genes in this pathway
JIANG VHL TARGETS 138 91 All SZGR 2.0 genes in this pathway
LU AGING BRAIN UP 262 186 All SZGR 2.0 genes in this pathway
LIU SMARCA4 TARGETS 64 39 All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN 287 208 All SZGR 2.0 genes in this pathway
BILD MYC ONCOGENIC SIGNATURE 206 117 All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER T4 94 69 All SZGR 2.0 genes in this pathway
CAMPS COLON CANCER COPY NUMBER DN 74 34 All SZGR 2.0 genes in this pathway
OSADA ASCL1 TARGETS DN 24 20 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN 701 446 All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR DN 546 362 All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA D DN 78 34 All SZGR 2.0 genes in this pathway
GOLDRATH ANTIGEN RESPONSE 346 192 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN 366 257 All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS DN 435 289 All SZGR 2.0 genes in this pathway
HOFFMANN PRE BI TO LARGE PRE BII LYMPHOCYTE DN 75 61 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069 729 All SZGR 2.0 genes in this pathway
CROONQUIST IL6 DEPRIVATION UP 20 10 All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G1 UP 113 70 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 349 234 All SZGR 2.0 genes in this pathway
CHIARETTI T ALL RELAPSE PROGNOSIS 19 15 All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 210 148 All SZGR 2.0 genes in this pathway
LI INDUCED T TO NATURAL KILLER UP 307 182 All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT 567 365 All SZGR 2.0 genes in this pathway
FIGUEROA AML METHYLATION CLUSTER 1 DN 48 30 All SZGR 2.0 genes in this pathway
FIGUEROA AML METHYLATION CLUSTER 3 DN 42 24 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 UP 430 288 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B 549 316 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE 1137 655 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE EARLY LATE 317 190 All SZGR 2.0 genes in this pathway
ISSAEVA MLL2 TARGETS 62 35 All SZGR 2.0 genes in this pathway
PASINI SUZ12 TARGETS DN 315 215 All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3 824 528 All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D 658 397 All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN 784 464 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-124.1 235 242 1A,m8 hsa - mir - 124 a UUAAGGCACGCGGUGAAUGCCA
miR-124/506 235 241 1A hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brain UAAGGCACGCGGUGAAUGCC
miR-17-5p/20/93.mr/106/519.d 764 771 1A,m8 hsa-miR-17-5p CAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrain UAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106a AAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZ UAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZ CAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUGU
miR-30-5p 288 294 m8 hsa-miR-30a-5p UGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrain UGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZ UGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZ UGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5p UGUAAACAUCCUUGACUGGA
miR-329 57 63 m8 hsa-miR-329brain AACACACCUGGUUAACCUCUUU