Gene Page:ATG9A

Summary?
GeneID 79065
Symbol ATG9A
Synonyms APG9L1|MGD3208|mATG9
Description autophagy related 9A
Reference MIM:612204|HGNC:HGNC:22408|Ensembl:ENSG00000198925|HPRD:07979|Vega:OTTHUMG00000154557
Gene type protein-coding
Map location 2q35
Pascal p-value 2.321E-5
Sherlock p-value 4.203E-5
Fetal beta -0.067
eGene Cerebellum
Myers' cis & trans
Support CompositeSet
Darnell FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.00916
GSMA_IIE Genome scan meta-analysis (European-ancestry samples) Psr: 0.01016

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs4425711 chr7 54637269 ATG9A 79065 0.17 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
VPS35 0.87 0.85
MUDENG 0.87 0.85
HIAT1 0.86 0.84
SLC30A9 0.86 0.84
NIPA2 0.85 0.82
PIAS2 0.85 0.83
YIPF5 0.85 0.84
KIAA1715 0.85 0.86
AKAP10 0.85 0.86
PSMD5 0.85 0.82
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
MT-CO2 -0.69 -0.62
AF347015.8 -0.69 -0.62
AF347015.21 -0.69 -0.59
MT-CYB -0.67 -0.60
AF347015.2 -0.66 -0.57
AF347015.31 -0.66 -0.60
AF347015.33 -0.65 -0.58
AF347015.26 -0.65 -0.57
AF347015.15 -0.65 -0.59
AF347015.18 -0.64 -0.62

Section III. Gene Ontology annotation

Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0000045 autophagic vacuole formation IMP 15755735
GO:0006914 autophagy IEA -
GO:0015031 protein transport IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005737 cytoplasm IEA -
GO:0005776 autophagic vacuole IEA -
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -
GO:0031410 cytoplasmic vesicle IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
HORIUCHI WTAP TARGETS DN 310 188 All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN 536 332 All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP 566 371 All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN UP 439 257 All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS DN 668 419 All SZGR 2.0 genes in this pathway
金所有障碍少突细胞数量ORR UP 756 494 All SZGR 2.0 genes in this pathway
LINSLEY MIR16 TARGETS 206 127 All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A 770 480 All SZGR 2.0 genes in this pathway
MIZUSHIMA AUTOPHAGOSOME FORMATION 19 15 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-28 925 931 1A hsa-miR-28brain AAGGAGCUCACAGUCUAUUGAG
miR-29 251 258 1A,m8 hsa-miR-29aSZ UAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZ UAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZ UAGCACCAUUUGAAAUCGGU
miR-338 914 920 m8 hsa-miR-338brain UCCAGCAUCAGUGAUUUUGUUGA
miR-34/449 286 292 1A hsa-miR-34abrain UGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34c AGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449 UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC
miR-96 362 368 m8 hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC
hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC