Gene Page:PRRC2A

Summary?
GeneID 7916
Symbol PRRC2A
Synonyms BAT2|D6S51|D6S51E|G2
Description proline rich coiled-coil 2A
Reference MIM:142580|HGNC:HGNC:13918|Ensembl:ENSG00000204469|HPRD:00807|Vega:OTTHUMG00000031168
Gene type protein-coding
Map location 6p21.3
Pascal p-value 1E-12
Sherlock p-value 0.319
TADA p-value 0.006
Fetal beta 0.061
eGene 元
Support CompositeSet

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWAScat Genome-wide Association Studies This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
DNM:Fromer_2014 Whole Exome Sequencing analysis This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.

Section I. Genetics and epigenetics annotation

@DNM table

Gene Chromosome Position Ref Alt Transcript AA change Mutation type Sift CG46 Trait Study
PRRC2A chr6 31605070..31605071 TC T NM_004638
NM_004638
NM_080686
NM_080686		 .
p.2158*>x
.
p.2158*>x		 frameshift
read-through
frameshift
read-through		 Schizophrenia DNM:Fromer_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
某fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005515 protein binding 新闻学会 14667819|16713569
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -
GO:0005737 cytoplasm IEA -

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
C1QBP GC1QBP | HABP1 | SF2p32 | gC1Q-R | gC1qR | p32 complement component 1, q subcomponent binding protein - HPRD,BioGRID 14667819
CCR10 GPR2 chemokine (C-C motif) receptor 10 - HPRD,BioGRID 14667819
CPSF1 CPSF160 | HSU37012 | P / cl.18 cleavage and polyadenylation specific factor 1, 160kDa - HPRD,BioGRID 14667819
DDX20 DKFZp434H052 | DP103 | GEMIN3 DEAD (Asp-Glu-Ala-Asp) box polypeptide 20 - HPRD,BioGRID 14667819
EIF3E EIF3-P48 | EIF3S6 | INT6 | eIF3-p46 eukaryotic translation initiation factor 3, subunit E - HPRD,BioGRID 14667819
FGA Fib2 | MGC119422 | MGC119423 | MGC119425 fibrinogen alpha chain - HPRD,BioGRID 14667819
GANAB G2AN | GluII | KIAA0088 glucosidase, alpha; neutral AB - HPRD,BioGRID 14667819
GRB2 ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084 growth factor receptor-bound protein 2 - HPRD,BioGRID 14667819
HNRNPA1 HNRPA1 | MGC102835 heterogeneous nuclear ribonucleoprotein A1 - HPRD,BioGRID 14667819
HNRNPM DKFZp547H118 | HNRNPM4 | HNRPM | HNRPM4 | HTGR1 | NAGR1 heterogeneous nuclear ribonucleoprotein M - HPRD,BioGRID 14667819
IFT88 D13S1056E | DAF19 | MGC26259 | RP11-172H24.2 | TG737 | TTC10 | hTg737 intraflagellar transport 88 homolog (Chlamydomonas) - HPRD,BioGRID 14667819
IMMT DKFZp779P1653 | HMP | MGC111146 | P87 | P87/89 | P89 | PIG4 | PIG52 inner membrane protein, mitochondrial (mitofilin) - HPRD,BioGRID 14667819
MAD2L2 MAD2B | REV7 MAD2 mitotic arrest deficient-like 2 (yeast) - HPRD,BioGRID 14667819
MAN2C1 DKFZp686E23167 | MAN6A8 | MANA | MANA1 | MGC87979 mannosidase, alpha, class 2C, member 1 - HPRD,BioGRID 14667819
P4HA2 - procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II - HPRD,BioGRID 14667819
PRMT2 HRMT1L1 | MGC111373 protein arginine methyltransferase 2 - HPRD,BioGRID 14667819
PSMA3 HC8 | MGC12306 | MGC32631 | PSC3 proteasome (prosome, macropain) subunit, alpha type, 3 - HPRD,BioGRID 14667819
QARS GLNRS | PRO2195 glutaminyl-tRNA synthetase - HPRD,BioGRID 14667819
SSR3 TRAPG signal sequence receptor, gamma (translocon-associated protein gamma) - HPRD,BioGRID 14667819
UBAP2L FLJ42300 | KIAA0144 | NICE-4 ubiquitin associated protein 2-like - HPRD,BioGRID 14667819


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
WILCOX RESPONSE TO PROGESTERONE DN 66 44 All SZGR 2.0 genes in this pathway
GARY CD5 TARGETS UP 473 314 All SZGR 2.0 genes in this pathway
HUTTMANN B CLL POOR SURVIVAL UP 276 187 All SZGR 2.0 genes in this pathway
LAIHO COLORECTAL CANCER SERRATED DN 86 47 All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN 335 193 All SZGR 2.0 genes in this pathway
GINESTIER乳腺癌20问题AMPLIFICATION DN 180 101 All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS UP 414 287 All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP 479 299 All SZGR 2.0 genes in this pathway
LIAO METASTASIS 539 324 All SZGR 2.0 genes in this pathway
SMITH TERT TARGETS UP 145 91 All SZGR 2.0 genes in this pathway
LIN APC TARGETS 77 55 All SZGR 2.0 genes in this pathway
LENAOUR DENDRITIC CELL MATURATION DN 128 90 All SZGR 2.0 genes in this pathway
FAELT B CLL WITH VH3 21 UP 44 30 All SZGR 2.0 genes in this pathway
WELCSH BRCA1 TARGETS DN 141 92 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED 1022 619 All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3 718 401 All SZGR 2.0 genes in this pathway
MIKKELSEN NPC ICP WITH H3K4ME3 445 257 All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B 517 302 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-374 42 48 1A hsa-miR-374 UUAUAAUACAACCUGAUAAGUG
miR-381 31 38 1A,m8 hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
miR-495 145 152 1A,m8 hsa-miR-495brain AAACAAACAUGGUGCACUUCUUU