Gene Page:CALCA

Summary?
GeneID 796
Symbol CALCA
Synonyms CALC1|CGRP|CGRP-I|CGRP1|CT|KC|PCT
Description calcitonin related polypeptide alpha
Reference MIM:114130|HGNC:HGNC:1437|Ensembl:ENSG00000110680|HPRD:00238|Vega:OTTHUMG00000159731
Gene type protein-coding
Map location 11p15.2
Pascal p-value 0.706
DMG 1(#研究)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 4
PMID:cooccur High-throughput literature-search 系统搜索PubMed的基因co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 4

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg26833169 11 14994045 CALCA 4.48E-5 -0.381 0.021 DMG:Wockner_2014
cg09188980 11 14993378 CALCA 1E-4 -0.53 0.028 DMG:Wockner_2014
cg25783352 11 14993509 CALCA 1.029E-4 -0.449 0.028 DMG:Wockner_2014
cg22863523 11 14995201 CALCA 3.306E-4 0.939 0.041 DMG:Wockner_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
GOLIM4 0.81 0.83
COBLL1 0.78 0.79
TLN1 0.75 0.81
PTRF 0.73 0.76
CGNL1 0.72 0.78
FYCO1 0.72 0.82
COL14A1 0.71 0.73
GIMAP8 0.71 0.74
MYH11 0.71 0.71
FAM129A 0.70 0.73
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
ZNF32 -0.49 -0.59
COMMD3 -0.47 -0.56
NDUFAF2 -0.47 -0.55
PFDN5 -0.47 -0.59
PHPT1 -0.46 -0.57
OXSM -0.46 -0.54
C11orf73 -0.46 -0.54
MRPS24 -0.46 -0.50
AC034193.4 -0.46 -0.50
DCTN3 -0.46 -0.49

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005179 hormone activity IEA -
GO:0031716 calcitonin receptor binding IEA -
GO:0031716 calcitonin receptor binding 新闻学会 8078488|8940110
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007218 神经肽p信号athway IEA Neurotransmitter (GO term level: 8) -
GO:0001984 vasodilation of artery during baroreceptor response to increased systemic arterial blood pressure IEA -
GO:0002027 regulation of heart rate IEA -
GO:0001944 vasculature development IDA 17267696
GO:0001935 endothelial cell proliferation IDA 17267696
GO:0001976 regulation of systemic arterial blood pressure by neurological process IDA 10642343
GO:0007190 activation of adenylate cyclase activity IDA 10822112|16014619
GO:0007267 cell-cell signaling 助教 2408883
GO:0009408 response to heat IEA -
GO:0007631 feeding behavior IEA -
GO:0007566 embryo implantation IDA 17983652
GO:0006954 inflammatory response IEA -
GO:0007159 leukocyte adhesion IDA 1326102
GO:0016481 negative regulation of transcription IDA 11014233
GO:0050965 detection of temperature stimulus involved in sensory perception of pain IEA -
GO:0032757 positive regulation of interleukin-8 production IDA 16904178
GO:0032730 positive regulation of interleukin-1 alpha production IDA 16904178
GO:0048265 response to pain IEA -
GO:0030279 negative regulation of ossification IEA -
GO:0031645 negative regulation of neurological system process IEA -
GO:0032147 activation of protein kinase activity IDA 17983652
GO:0045779 negative regulation of bone resorption IDA 10822112|17241109
GO:0045778 positive regulation of ossification IEA -
GO:0045651 positive regulation of macrophage differentiation IDA 10822112
GO:0045762 positive regulation of adenylate cyclase activity IDA 8078488|11014233
GO:0045909 positive regulation of vasodilation IDA 3266556
GO:0045671 negative regulation of osteoclast differentiation IDA 10822112
GO:0043542 endothelial cell migration IDA 17267696
GO:0045986 negative regulation of smooth muscle contraction IEA -
GO:0045776 negative regulation of blood pressure IDA 10642343
GO:0051480 cytosolic calcium ion homeostasis IDA 9685362
GO:0051482 elevation of cytosolic calcium ion concentration during G-protein signaling, coupled to IP3 second messenger (phospholipase C activating) IDA 8078488|9685362
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0043025 cell soma IEA axon, dendrite (GO term level: 4) -
GO:0043195 terminal button IEA axon, Synap, Neurotransmitter (GO term level: 8) -
GO:0030424 axon IEA neuron, axon, Neurotransmitter (GO term level: 6) -
GO:0005576 extracellular region IEA -
GO:0005615 extracellular space IDA 2408883|18057382
GO:0005622 intracellular IEA -
GO:0005737 cytoplasm IDA 17267696

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
REACTOME SIGNALING BY GPCR 920 449 All SZGR 2.0 genes in this pathway
REACTOME CLASS B 2 SECRETIN FAMILY RECEPTORS 88 58 All SZGR 2.0 genes in this pathway
REACTOME GPCR DOWNSTREAM SIGNALING 805 368 All SZGR 2.0 genes in this pathway
REACTOME G ALPHA S SIGNALLING EVENTS 121 82 All SZGR 2.0 genes in this pathway
REACTOME GPCR LIGAND BINDING 408 246 All SZGR 2.0 genes in this pathway
REACTOME AMYLOIDS 83 63 All SZGR 2.0 genes in this pathway
CONCANNON APOPTOSIS BY EPOXOMICIN UP 239 157 All SZGR 2.0 genes in this pathway
TANAKA METHYLATED IN ESOPHAGEAL CARCINOMA 103 58 All SZGR 2.0 genes in this pathway
SCHLESINGER METHYLATED DE NOVO IN CANCER 88 64 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR UP 176 115 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 12HR DN 57 45 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP 487 286 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
KANG IMMORTALIZED BY TERT DN 102 67 All SZGR 2.0 genes in this pathway
BRUNO HEMATOPOIESIS 66 48 All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP 430 288 All SZGR 2.0 genes in this pathway
NAKAMURA METASTASIS MODEL DN 43 28 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR UP 293 203 All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 14 143 86 All SZGR 2.0 genes in this pathway
KOHOUTEK CCNT2 TARGETS 58 35 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-488 247 253 m8 hsa-miR-488 CCCAGAUAAUGGCACUCUCAA