Gene Page:SH3TC2
Summary?
| GeneID | 79628 |
| Symbol | SH3TC2 |
| Synonyms | CMT4C|MNMN |
| Description | SH3 domain and tetratricopeptide repeats 2 |
| Reference | MIM:608206|HGNC:HGNC:29427|HPRD:10496| |
| Gene type | protein-coding |
| Map location | 5q32 |
| Pascal p-value | 0.644 |
| TADA p-value | 0.018 |
| Fetal beta | 0.26 |
| Support | CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
| PMID:cooccur | High-throughput literature-search | 系统搜索PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0032 | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01718 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00459 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
DNM table
DNM table| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| SH3TC2 | chr5 | 148407572 | A | T | NM_024577 | p.575L>M | missense | Schizophrenia | DNM:Fromer_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MLF1 | 0.84 | 0.73 |
| SPA17 | 0.84 | 0.75 |
| C9orf98 | 0.81 | 0.71 |
| C20orf26 | 0.81 | 0.74 |
| C9orf116 | 0.81 | 0.74 |
| FBXO15 | 0.80 | 0.61 |
| WDR69 | 0.80 | 0.78 |
| FAM164C | 0.79 | 0.64 |
| KIF9 | 0.79 | 0.72 |
| MDH1B | 0.78 | 0.72 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.18 | -0.32 | -0.22 |
| SCUBE1 | -0.30 | -0.31 |
| SATB2 | -0.29 | -0.12 |
| ANP32C | -0.29 | -0.37 |
| SLA | -0.29 | 0.09 |
| AF347015.2 | -0.29 | -0.14 |
| AC010300.1 | -0.28 | -0.34 |
| AF347015.26 | -0.27 | -0.16 |
| AC100783.1 | -0.27 | -0.24 |
| MPPED1 | -0.26 | -0.06 |
Section III. Gene Ontology annotation
| Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005488 | binding | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| SABATES COLORECTAL ADENOMA UP | 141 | 75 | All SZGR 2.0 genes in this pathway |
| KOYAMA SEMA3B TARGETS UP | 292 | 168 | All SZGR 2.0 genes in this pathway |
| LIN SILENCED BY TUMOR MICROENVIRONMENT | 108 | 73 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS MATURE CELL | 293 | 160 | All SZGR 2.0 genes in this pathway |
| HAN SATB1 TARGETS UP | 395 | 249 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN ES ICP WITH H3K4ME3 | 718 | 401 | All SZGR 2.0 genes in this pathway |
| CHYLA CBFA2T3 TARGETS DN | 242 | 146 | All SZGR 2.0 genes in this pathway |
| TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN | 321 | 200 | All SZGR 2.0 genes in this pathway |
| FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
| PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-1/206 | 2414 | 2420 | m8 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
| hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
| hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
| miR-125/351 | 409 | 416 | 1A,m8 | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
| hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
| miR-208 | 16991 | 16997 | 1A | hsa-miR-208 | AUAAGACGAGCAAAAAGCUUGU |
| miR-324-3p | 6351 | 6358 | 1A,m8 | hsa-miR-324-3p | CCACUGCCCCAGGUGCUGCUGG |
| miR-409-3p | 2413 | 2419 | m8 | hsa-miR-409-3p | CGAAUGUUGCUCGGUGAACCCCU |
| miR-431 | 17892 | 17899 | 1A,m8 | hsa-miR-431 | UGUCUUGCAGGCCGUCAUGCA |
| miR-496 | 716 | 723 | 1A,m8 | hsa-miR-496 | AUUACAUGGCCAAUCUC |
| miR-499 | 16990 | 16997 | 1A,m8 | hsa-miR-499 | UUAAGACUUGCAGUGAUGUUUAA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.