Gene Page:PANK3
Summary?
GeneID | 79646 |
Symbol | PANK3 |
Synonyms | - |
Description | pantothenate kinase 3 |
Reference | MIM:606161|HGNC:HGNC:19365|HPRD:07312| |
Gene type | protein-coding |
Map location | 5q34 |
Pascal p-value | 0.034 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.0276 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/PANK3_DE_GTEx.png)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13- 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0005524 | ATP binding | IEA | - | |
GO:0004594 | pantothenate kinase activity | IEA | - | |
GO:0016740 | transferase activity | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0015937 | coenzyme A biosynthetic process | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG PANTOTHENATE AND COA BIOSYNTHESIS | 16 | 9 | All SZGR 2.0 genes in this pathway |
REACTOME VITAMIN B5 PANTOTHENATE METABOLISM | 11 | 7 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF VITAMINS AND COFACTORS | 51 | 36 | All SZGR 2.0 genes in this pathway |
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS TURQUOISE UP | 79 | 50 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 5 6WK DN | 137 | 97 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 6 7WK UP | 197 | 135 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
GARCIA TARGETS OF FLI1 AND DAX1 DN | 176 | 104 | All SZGR 2.0 genes in this pathway |
KOYAMA SEMA3B TARGETS UP | 292 | 168 | All SZGR 2.0 genes in this pathway |
SHEN SMARCA2 TARGETS UP | 424 | 268 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 20HR UP | 240 | 152 | All SZGR 2.0 genes in this pathway |
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP | 314 | 201 | All SZGR 2.0 genes in this pathway |
LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
JI RESPONSE TO FSH DN | 58 | 43 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
HOWLIN CITED1 TARGETS 1 UP | 35 | 25 | All SZGR 2.0 genes in this pathway |
TING SILENCED BY DICER | 31 | 17 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR UP | 294 | 199 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND WITH H4K20ME1 MARK | 145 | 82 | All SZGR 2.0 genes in this pathway |
VERNOCHET ADIPOGENESIS | 19 | 11 | All SZGR 2.0 genes in this pathway |
PECE MAMMARY STEM CELL DN | 146 | 88 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-101 | 285 | 292 | 1A,m8 | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
miR-409-3p | 819 | 825 | 1A | hsa-miR-409-3p | CGAAUGUUGCUCGGUGAACCCCU |
miR-485-5p | 222 | 228 | m8 | hsa-miR-485-5p | AGAGGCUGGCCGUGAUGAAUUC |
miR-543 | 472 | 478 | 1A | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
miR-9 | 88 | 94 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.