Gene Page:FZD3

Summary?
GeneID 7976
Symbol FZD3
Synonyms Fz-3
Description frizzled class receptor 3
Reference MIM:606143|HGNC:HGNC:4041|Ensembl:ENSG00000104290|HPRD:05849|Vega:OTTHUMG00000102145
Gene type protein-coding
Map location 8p21
Pascal p-value 0.012
Fetal beta 1.462
DMG 1 (# studies)
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 2
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association A combined odds ratio method (Sun et al. 2008), association studies 2 Link to SZGene
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.03086
GSMA_IIE Genome scan meta-analysis (European-ancestry samples) Psr: 0.00057
Literature High-throughput literature-search 与精神分裂症Co-occurance关键字s: schizophrenia,schizophrenic,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg06931245 8 28351501 FZD3 3.78E-5 -0.369 0.02 DMG:Wockner_2014
cg04046704 8 28352643 FZD3 4.319E-4 0.31 0.045 DMG:Wockner_2014

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs2341792 chr8 29333630 FZD3 7976 0.12 cis

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0004872 receptor activity IEA -
GO:0004930 G-protein coupled receptor activity IEA -
GO:0005515 protein binding IEA -
GO:0004926 non-G-protein coupled 7TM receptor activity IEA -
去:0042813 Wnt receptor activity TAS 10777673
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0001736 establishment of planar polarity IEA -
GO:0001843 neural tube closure IEA -
GO:0007186 G-protein coupled receptor protein signaling pathway IEA -
GO:0016055 Wnt receptor signaling pathway IEA -
GO:0008283 cell proliferation TAS 10491302
GO:0007275 multicellular organismal development IEA -
GO:0042472 inner ear morphogenesis IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0016020 membrane IEA -
GO:0005887 integral to plasma membrane TAS 10491302
GO:0045177 apical part of cell IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG WNT SIGNALING PATHWAY 151 112 All SZGR 2.0 genes in this pathway
KEGG MELANOGENESIS 102 80 All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER 328 259 All SZGR 2.0 genes in this pathway
KEGG BASAL CELL CARCINOMA 55 44 All SZGR 2.0 genes in this pathway
WNT SIGNALING 89 71 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR 920 449 All SZGR 2.0 genes in this pathway
REACTOME CLASS B 2 SECRETIN FAMILY RECEPTORS 88 58 All SZGR 2.0 genes in this pathway
REACTOME GPCR LIGAND BINDING 408 246 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN 805 505 All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM5 94 59 All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN 584 395 All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS 734 436 All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 DN 464 276 All SZGR 2.0 genes in this pathway
ONDER CDH1 SIGNALING VIA CTNNB1 83 58 All SZGR 2.0 genes in this pathway
OKUMURA INFLAMMATORY RESPONSE LPS 183 115 All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS 882 572 All SZGR 2.0 genes in this pathway
AFFAR YY1 TARGETS DN 234 137 All SZGR 2.0 genes in this pathway
DELASERNA MYOD TARGETS UP 89 51 All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY UP 487 303 All SZGR 2.0 genes in this pathway
OUILLETTE CLL 13Q14 DELETION DN 60 38 All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS DN 138 92 All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA CLASSICAL 162 122 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-182 942 949 1A,m8 hsa-miR-182 UUUGGCAAUGGUAGAACUCACA
miR-31 940 947 1A,m8 hsa-miR-31 AGGCAAGAUGCUGGCAUAGCUG
miR-378* 1101 1107 1A hsa-miR-422b CUGGACUUGGAGUCAGAAGGCC
hsa-miR-422a CUGGACUUAGGGUCAGAAGGCC
miR-96 943 949 1A hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC