Gene Page:BORA

Summary?
GeneID 79866
Symbol BORA
Synonyms C13orf34
Description bora, aurora kinase A activator
Reference MIM:610510|HGNC:HGNC:24724|Ensembl:ENSG00000136122|HPRD:13389|Vega:OTTHUMG00000017068
Gene type protein-coding
Map location 13q22.1
Pascal p-value 0.012

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search 系统search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizotypy,schizophrenias,schizotypal Click to show details

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007049 cell cycle IEA -
GO:0007067 mitosis IEA -
GO:0051301 cell division IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PID PLK1 PATHWAY 46 25 All SZGR 2.0 genes in this pathway
BASAKI YBX1 TARGETS UP 290 177 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP 722 443 All SZGR 2.0 genes in this pathway
PROVENZANI METASTASIS UP 194 112 All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN 1024 594 All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES 648 385 All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215 893 528 All SZGR 2.0 genes in this pathway
SHEPARD CRUSH AND BURN MUTANT DN 185 111 All SZGR 2.0 genes in this pathway
MARSON BOUND BY E2F4 UNSTIMULATED 728 415 All SZGR 2.0 genes in this pathway
TOYOTA TARGETS OF MIR34B AND MIR34C 463 262 All SZGR 2.0 genes in this pathway
CHUNG BLISTER CYTOTOXICITY UP 134 84 All SZGR 2.0 genes in this pathway
GRADE COLON AND RECTAL CANCER UP 285 167 All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES UP 605 377 All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE G2 182 102 All SZGR 2.0 genes in this pathway
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 DN 157 106 All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN 882 538 All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS DN 553 343 All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION UP 570 339 All SZGR 2.0 genes in this pathway
ZHOU CELL CYCLE GENES IN IR RESPONSE 2HR 8 5 All SZGR 2.0 genes in this pathway
ZHOU CELL CYCLE GENES IN IR RESPONSE 24HR 128 73 All SZGR 2.0 genes in this pathway
ZWANG DOWN BY 2ND EGF PULSE 293 119 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-23 125 132 1A,m8 hsa-miR-23abrain AUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrain AUCACAUUGCCAGGGAUUACC
miR-323 124 131 1A,m8 hsa-miR-323brain GCACAUUACACGGUCGACCUCU
miR-504 289 296 1A,m8 hsa-miR-504 AGACCCUGGUCUGCACUCUAU