Gene Page:CNTNAP3

Summary?
GeneID 79937
Symbol CNTNAP3
Synonyms CASPR3|CNTNAP3A
Description contactin associated protein-like 3
Reference MIM:610517|HGNC:HGNC:13834|Ensembl:ENSG00000106714|HPRD:10842|Vega:OTTHUMG00000019954
Gene type protein-coding
Map location 9p13.1
Pascal p-value 0.051
Fetal beta 1.058
eGene Cortex

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0005102 receptor binding IEA Neurotransmitter (GO term level: 4) -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007155 cell adhesion IEA -
GO:0007165 signal transduction IEA -
GO:0008037 cell recognition NAS 12093160
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005576 extracellular region IEA -
GO:0016021 integral to membrane NAS 12093160
GO:0005886 plasma membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
HOOI ST7 TARGETS DN 123 78 All SZGR 2.0 genes in this pathway
BASAKI YBX1 TARGETS DN 384 230 All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP 501 327 All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174 695 All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS UP 292 168 All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS 988 594 All SZGR 2.0 genes in this pathway
BENPORATH OCT4 TARGETS 290 172 All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215 893 528 All SZGR 2.0 genes in this pathway
KONDO EZH2 TARGETS 245 148 All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3 824 528 All SZGR 2.0 genes in this pathway
GHANDHI BYSTANDER IRRADIATION DN 12 10 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839 928 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-181 725 731 m8 hsa-miR-181abrain AACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZ AACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrain AACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrain AACAUUCAUUGUUGUCGGUGGGUU
miR-543 726 733 1A,m8 hsa-miR-543 AAACAUUCGCGGUGCACUUCU