Gene Page:ATAT1

Summary?
GeneID 79969
Symbol ATAT1
Synonyms C6orf134|MEC17|Nbla00487|TAT|alpha-TAT|alpha-TAT1
Description alpha tubulin acetyltransferase 1
Reference MIM:615556|HGNC:HGNC:21186|Ensembl:ENSG00000137343|HPRD:12850|Vega:OTTHUMG00000031219
Gene type protein-coding
Map location 6p21.33
Pascal p-value 2.209E-14
Sherlock p-value 0.655
Fetal beta 2.009
eGene Frontal Cortex BA9
Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs17795337 chr6 136492658 ATAT1 79969 0.15 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN 335 193 All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN 164 111 All SZGR 2.0 genes in this pathway
TONG INTERACT WITH PTTG1 57 32 All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C D DN 252 155 All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA CHEMOTAXIS DN 457 302 All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA PCA1 UP 101 66 All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL 177 132 All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN 1080 713 All SZGR 2.0 genes in this pathway
若林史江脂肪生成PPARG RXRA 8 d 882 506 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-141/200a 1582 1588 m8 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
hsa-miR-200a UAACACUGUCUGGUAACGAUGU
miR-150 1530 1536 m8 hsa-miR-150 UCUCCCAACCCUUGUACCAGUG
miR-182 1121 1128 1A,m8 hsa-miR-182 UUUGGCAAUGGUAGAACUCACA
miR-185 451 457 m8 hsa-miR-185brain UGGAGAGAAAGGCAGUUC
miR-218 852 858 m8 hsa-miR-218brain UUGUGCUUGAUCUAACCAUGU
miR-342 1354 1360 1A hsa-miR-342brain UCUCACACAGAAAUCGCACCCGUC
miR-96 1122 1128 1A hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC