Gene Page:RUFY1
Summary?
GeneID | 80230 |
Symbol | RUFY1 |
Synonyms | RABIP4|ZFYVE12 |
Description | RUN and FYVE domain containing 1 |
Reference | MIM:610327|HGNC:HGNC:19760|Ensembl:ENSG00000176783|HPRD:15282|Vega:OTTHUMG00000130913 |
Gene type | protein-coding |
Map location | 5q35.3 |
Pascal p-value | 0.061 |
Sherlock p-value | 0.656 |
Fetal beta | 0.523 |
DMG | 1 (# studies) |
Support | Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.0276 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg21951679 | 5 | 178977648 | RUFY1 | 5.308E-4 | -0.209 | 0.048 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IEA | - | |
GO:0008289 | lipid binding | IEA | - | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0008565 | protein transporter activity | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0030100 | regulation of endocytosis | IEA | - | |
GO:0015031 | protein transport | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005768 | endosome | IEA | - | |
GO:0016020 | membrane | IEA | - | |
GO:0031901 | early endosome membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG ENDOCYTOSIS | 183 | 132 | All SZGR 2.0 genes in this pathway |
KIM GERMINAL CENTER T HELPER UP | 66 | 42 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
LEE AGING NEOCORTEX UP | 89 | 59 | All SZGR 2.0 genes in this pathway |
TSENG IRS1 TARGETS UP | 113 | 71 | All SZGR 2.0 genes in this pathway |
RAGHAVACHARI PLATELET SPECIFIC GENES | 70 | 46 | All SZGR 2.0 genes in this pathway |
LU EZH2 TARGETS DN | 414 | 237 | All SZGR 2.0 genes in this pathway |
FIGUEROA AML METHYLATION CLUSTER 1 DN | 48 | 30 | All SZGR 2.0 genes in this pathway |
WIERENGA STAT5A TARGETS DN | 213 | 127 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
DELACROIX RARG BOUND MEF | 367 | 231 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 385 | 391 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-182 | 16 | 22 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-96 | 15 | 22 | 1A,m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.