Gene Page:RUFY1

Summary?
GeneID 80230
Symbol RUFY1
Synonyms RABIP4|ZFYVE12
Description RUN and FYVE domain containing 1
Reference MIM:610327|HGNC:HGNC:19760|Ensembl:ENSG00000176783|HPRD:15282|Vega:OTTHUMG00000130913
Gene type protein-coding
Map location 5q35.3
Pascal p-value 0.061
Sherlock p-value 0.656
Fetal beta 0.523
DMG 1 (# studies)
Support Ascano FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.0276

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg21951679 5 178977648 RUFY1 5.308E-4 -0.209 0.048 DMG:Wockner_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005515 protein binding IEA -
GO:0008289 lipid binding IEA -
GO:0008270 zinc ion binding IEA -
GO:0008565 protein transporter activity IEA -
GO:0046872 metal ion binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0030100 regulation of endocytosis IEA -
GO:0015031 protein transport IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005737 cytoplasm IEA -
GO:0005768 endosome IEA -
GO:0016020 membrane IEA -
GO:0031901 early endosome membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG ENDOCYTOSIS 183 132 All SZGR 2.0 genes in this pathway
KIM GERMINAL CENTER T HELPER UP 66 42 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 1691 1088 All SZGR 2.0 genes in this pathway
LEE AGING NEOCORTEX UP 89 59 All SZGR 2.0 genes in this pathway
TSENG IRS1 TARGETS UP 113 71 All SZGR 2.0 genes in this pathway
RAGHAVACHARI PLATELET SPECIFIC GENES 70 46 All SZGR 2.0 genes in this pathway
LU EZH2 TARGETS DN 414 237 All SZGR 2.0 genes in this pathway
FIGUEROA AML METHYLATION CLUSTER 1 DN 48 30 All SZGR 2.0 genes in this pathway
WIERENGA STAT5A TARGETS DN 213 127 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE 1137 655 All SZGR 2.0 genes in this pathway
DELACROIX RARG BOUND MEF 367 231 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-124/506 385 391 m8 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brain UAAGGCACGCGGUGAAUGCC
miR-182 16 22 1A hsa-miR-182 UUUGGCAAUGGUAGAACUCACA
miR-96 15 22 1A,m8 hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC