Gene Page:BPIFB2
Summary?
| GeneID | 80341 |
| Symbol | BPIFB2 |
| Synonyms | BPIL1|C20orf184|LPLUNC2|RYSR|dJ726C3.2 |
| Description | BPI fold containing family B member 2 |
| Reference | MIM:614108|HGNC:HGNC:16177|Ensembl:ENSG00000078898|HPRD:10690|Vega:OTTHUMG00000032232 |
| Gene type | protein-coding |
| Map location | 20q11.21 |
| Pascal p-value | 0.027 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| DDR1 | 0.82 | 0.84 |
| AL161668.2 | 0.82 | 0.84 |
| PARD3 | 0.81 | 0.74 |
| SPATA13 | 0.80 | 0.73 |
| SALL2 | 0.80 | 0.83 |
| PALLD | 0.80 | 0.75 |
| ERBB2 | 0.79 | 0.77 |
| 认为BP | 0.79 | 0.66 |
| AC130686.2 | 0.78 | 0.76 |
| TSPAN11 | 0.78 | 0.80 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| C5orf53 | -0.45 | -0.52 |
| CA4 | -0.44 | -0.51 |
| AF347015.31 | -0.44 | -0.54 |
| CA11 | -0.42 | -0.51 |
| HSPB3 | -0.42 | -0.55 |
| RERGL | -0.42 | -0.62 |
| CXCL14 | -0.41 | -0.54 |
| KRT17 | -0.41 | -0.61 |
| MYL3 | -0.41 | -0.54 |
| AF347015.27 | -0.41 | -0.49 |
Section III. Gene Ontology annotation
| Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0008289 | lipid binding | IEA | - | |
| Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
| GO:0005576 | extracellular region | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| RICKMAN HEAD AND NECK CANCER D | 37 | 14 | All SZGR 2.0 genes in this pathway |
| STONER ESOPHAGEAL CARCINOGENESIS UP | 39 | 25 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS LATE PROGENITOR | 544 | 307 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-335 | 307 | 313 | 1A | hsa-miR-335brain | UCAAGAGCAAUAACGAAAAAUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.