Gene Page:PRR7

Summary?
GeneID 80758
Symbol PRR7
Synonyms -
Description proline rich 7 (synaptic)
Reference HGNC:HGNC:28130|Ensembl:ENSG00000131188|HPRD:15186|Vega:OTTHUMG00000130861
Gene type protein-coding
Map location 5q35.3
Pascal p-value 0.275
Sherlock p-value 0.01
Fetal beta -0.217
DMG 1 (# studies)
eGene Myers' cis & trans
Support G2Cdb.humanPSD
G2Cdb.humanPSP

Gene in Data Sources
Gene set name Method of gene set Description Info
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.0276
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg10208457 5 176874324 PRR7 2E-8 -0.02 6.96E-6 DMG:Jaffe_2016

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs1473812 chr13 33726536 PRR7 80758 0.15 trans
rs9635390 chr15 90809632 PRR7 80758 0.18 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
INO80D 0.92 0.90
CUGBP2 0.92 0.92
INSR 0.92 0.92
ABL2 0.92 0.93
TANC2 0.92 0.93
ZNF805 0.91 0.90
KIF1B 0.91 0.94
KIAA1632 0.91 0.94
GATAD2B 0.91 0.92
LCOR 0.90 0.92
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.31 -0.61 -0.77
SERPINB6 -0.61 -0.68
HSD17B14 -0.60 -0.71
FXYD1 -0.60 -0.75
HIGD1B -0.60 -0.78
MT-CO2 -0.60 -0.76
IFI27 -0.59 -0.75
S100A16 -0.58 -0.73
RAMP1 -0.58 -0.70
AF347015.27 -0.58 -0.72

Section III. Gene Ontology annotation

Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0045211 postsynaptic membrane IEA Synap, Neurotransmitter (GO term level: 5) -
GO:0045202 synapse IEA neuron, Synap, Neurotransmitter, Glial (GO term level: 2) -
GO:0016021 integral to membrane IEA -
GO:0005886 plasma membrane IEA -
GO:0030054 cell junction IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
WANG SMARCE1 TARGETS DN 371 218 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN 911 527 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN 1011 592 All SZGR 2.0 genes in this pathway
BERNARD PPAPDC1B TARGETS DN 58 39 All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER POOR SURVIVAL A6 456 285 All SZGR 2.0 genes in this pathway
SHAFFER IRF4 TARGETS IN ACTIVATED DENDRITIC CELL 65 49 All SZGR 2.0 genes in this pathway
LI INDUCED T TO NATURAL KILLER UP 307 182 All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A 770 480 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-194 119 125 1A hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
miR-329 142 148 m8 hsa-miR-329brain AACACACCUGGUUAACCUCUUU
miR-377 144 150 m8 hsa-miR-377 AUCACACAAAGGCAACUUUUGU
miR-495 116 123 1A,m8 hsa-miR-495brain AAACAAACAUGGUGCACUUCUUU