Gene Page:PRRT1
Summary?
GeneID | 80863 |
Symbol | PRRT1 |
Synonyms | C6orf31|DSPD1|IFITMD7|NG5 |
Description | proline rich transmembrane protein 1 |
Reference | HGNC:HGNC:13943|Ensembl:ENSG00000204314|HPRD:10794|Vega:OTTHUMG00000031144 |
Gene type | protein-coding |
Map location | 6p21.32 |
Pascal p-value | 1E-12 |
Sherlock p-value | 9.733E-5 |
Fetal beta | -1.683 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
支持 | G2Cdb.humanPSD G2Cdb.humanPSP |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Montano_2016 | Genome-wide DNA methylation analysis | This dataset includes 172 replicated associations between CpGs with schizophrenia. | 1 |
GSMA_I | Genome scan meta-analysis | Psr: 0.033 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg20914572 | 6 | 32119874 | PRRT1 | 4.04E-4 | -0.006 | 0.198 | DMG:Montano_2016 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs3130501 | chr6 | 31136452 | PRRT1 | 80863 | 0.13 | cis | ||
rs12123144 | chr1 | 76550208 | PRRT1 | 80863 | 0.07 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/PRRT1_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
相约: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
DARWICHE PAPILLOMA PROGRESSION RISK | 74 | 44 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
XU GH1 EXOGENOUS TARGETS UP | 85 | 50 | All SZGR 2.0 genes in this pathway |
XU GH1 AUTOCRINE TARGETS UP | 268 | 157 | All SZGR 2.0 genes in this pathway |
MIKKELSEN IPS WITH HCP H3K27ME3 | 102 | 76 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
FIGUEROA AML METHYLATION CLUSTER 4 UP | 112 | 64 | All SZGR 2.0 genes in this pathway |
FIGUEROA AML METHYLATION CLUSTER 6 UP | 140 | 81 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-378 | 181 | 187 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.