Gene Page:PRRT1

Summary?
GeneID 80863
Symbol PRRT1
Synonyms C6orf31|DSPD1|IFITMD7|NG5
Description proline rich transmembrane protein 1
Reference HGNC:HGNC:13943|Ensembl:ENSG00000204314|HPRD:10794|Vega:OTTHUMG00000031144
Gene type protein-coding
Map location 6p21.32
Pascal p-value 1E-12
Sherlock p-value 9.733E-5
Fetal beta -1.683
DMG 1 (# studies)
eGene Myers' cis & trans
支持 G2Cdb.humanPSD
G2Cdb.humanPSP

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Montano_2016 Genome-wide DNA methylation analysis This dataset includes 172 replicated associations between CpGs with schizophrenia. 1
GSMA_I Genome scan meta-analysis Psr: 0.033

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg20914572 6 32119874 PRRT1 4.04E-4 -0.006 0.198 DMG:Montano_2016

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs3130501 chr6 31136452 PRRT1 80863 0.13 cis
rs12123144 chr1 76550208 PRRT1 80863 0.07 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
相约: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
DARWICHE PAPILLOMA PROGRESSION RISK 74 44 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
XU GH1 EXOGENOUS TARGETS UP 85 50 All SZGR 2.0 genes in this pathway
XU GH1 AUTOCRINE TARGETS UP 268 157 All SZGR 2.0 genes in this pathway
MIKKELSEN IPS WITH HCP H3K27ME3 102 76 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590 403 All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP 857 456 All SZGR 2.0 genes in this pathway
FIGUEROA AML METHYLATION CLUSTER 4 UP 112 64 All SZGR 2.0 genes in this pathway
FIGUEROA AML METHYLATION CLUSTER 6 UP 140 81 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY 1725 838 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-378 181 187 1A hsa-miR-378 CUCCUGACUCCAGGUCCUGUGU