Gene Page:STMN4

Summary?
GeneID 81551
Symbol STMN4
Synonyms RB3
Description stathmin 4
Reference HGNC:HGNC:16078|Ensembl:ENSG00000015592|HPRD:18120|Vega:OTTHUMG00000099461
Gene type protein-coding
Map location 8p21.2
Pascal p-value 0.043
Sherlock p-value 0.622
Fetal beta 0.592
eGene Caudate basal ganglia
Cortex
Hippocampus
Nucleus accumbens basal ganglia
Putamen basal ganglia
元

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWAScat Genome-wide Association Studies This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search 系统的search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I Genome scan meta-analysis Psr: 0.031
GSMA_IIE Genome scan meta-analysis (European-ancestry samples) Psr: 0.00057
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.03086
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs1562330 8 27098436 STMN4 ENSG00000015592.12 2.57902E-15 0 17501 gtex_brain_putamen_basal
rs17366947 8 27103024 STMN4 ENSG00000015592.12 2.57902E-15 0 12913 gtex_brain_putamen_basal
rs10481349 8 27104727 STMN4 ENSG00000015592.12 2.51219E-15 0 11210 gtex_brain_putamen_basal
rs28407392 8 27117727 STMN4 ENSG00000015592.12 1.25788E-11 0 -1790 gtex_brain_putamen_basal
rs62502378 8 27119012 STMN4 ENSG00000015592.12 1.79266E-6 0 -3075 gtex_brain_putamen_basal
rs1345134 8 27119538 STMN4 ENSG00000015592.12 2.52833E-6 0 -3601 gtex_brain_putamen_basal

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007242 intracellular signaling cascade IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
LEE NEURAL CREST STEM CELL UP 146 99 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA UP 544 308 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LPS UP 431 237 All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP 430 288 All SZGR 2.0 genes in this pathway
MCMURRAY TP53 HRAS COOPERATION RESPONSE DN 67 46 All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL 177 132 All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 10HR UP 199 143 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-135 173 179 m8 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUG
miR-150 210 216 1A hsa-miR-150 UCUCCCAACCCUUGUACCAGUG
miR-433-3p 522 528 m8 hsa-miR-433brain AUCAUGAUGGGCUCCUCGGUGU