Gene Page:TXNDC5
Summary?
GeneID | 81567 |
Symbol | TXNDC5 |
Synonyms | ENDOPDI|ERP46|HCC-2|HCC2|PDIA15|STRF8|UNQ364 |
Description | thioredoxin domain containing 5 (endoplasmic reticulum) |
Reference | MIM:616412|HGNC:HGNC:21073|Ensembl:ENSG00000239264|Ensembl:ENSG00000259040|HPRD:18249|Vega:OTTHUMG00000014216 |
Gene type | protein-coding |
Map location | 6p24.3 |
Sherlock p-value | 0.331 |
Fetal beta | 0.449 |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0159 | |
Literature | High-throughput literature-search | 与精神分裂症Co-occurance关键词:schizophrenia,schizophrenic,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs10515267 | chr5 | 100128201 | TXNDC5 | 81567 | 0.15 | trans | ||
rs11833888 | chr12 | 59350152 | TXNDC5 | 81567 | 0.17 | trans | ||
rs9548306 | chr13 | 38876011 | TXNDC5 | 81567 | 0.13 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/TXNDC5_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0016853 | isomerase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006916 | anti-apoptosis | TAS | 16130169 | |
GO:0045454 | cell redox homeostasis | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005788 | endoplasmic reticulum lumen | IEA | - | |
GO:0005783 | endoplasmic reticulum | TAS | 16130169 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME MEMBRANE TRAFFICKING | 129 | 74 | All SZGR 2.0 genes in this pathway |
REACTOME TRANS GOLGI NETWORK VESICLE BUDDING | 60 | 31 | All SZGR 2.0 genes in this pathway |
REACTOME LYSOSOME VESICLE BIOGENESIS | 23 | 11 | All SZGR 2.0 genes in this pathway |
REACTOME GOLGI ASSOCIATED VESICLE BIOGENESIS | 53 | 27 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
SANA TNF SIGNALING DN | 90 | 57 | All SZGR 2.0 genes in this pathway |
SANA RESPONSE TO IFNG DN | 85 | 56 | All SZGR 2.0 genes in this pathway |
HELLER SILENCED BY METHYLATION DN | 105 | 67 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS SILENCED BY METHYLATION DN | 281 | 179 | All SZGR 2.0 genes in this pathway |
SHAFFER IRF4 TARGETS IN MYELOMA VS MATURE B LYMPHOCYTE | 101 | 76 | All SZGR 2.0 genes in this pathway |
SHAFFER IRF4 TARGETS IN PLASMA CELL VS MATURE B LYMPHOCYTE | 67 | 51 | All SZGR 2.0 genes in this pathway |
SHAFFER IRF4 TARGETS IN ACTIVATED DENDRITIC CELL | 65 | 49 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA CHEMOTAXIS DN | 457 | 302 | All SZGR 2.0 genes in this pathway |
FIGUEROA AML METHYLATION CLUSTER 5 DN | 50 | 31 | All SZGR 2.0 genes in this pathway |
TERAO AOX4 TARGETS HG UP | 28 | 20 | All SZGR 2.0 genes in this pathway |
HUANG GATA2 TARGETS DN | 72 | 52 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-9 | 1068 | 1075 | 1A,m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.