Gene Page:NRIP1

Summary?
GeneID 8204
Symbol NRIP1
Synonyms RIP140
Description nuclear receptor interacting protein 1
Reference MIM:602490|HGNC:HGNC:8001|Ensembl:ENSG00000180530|HPRD:03927|Vega:OTTHUMG00000074323
Gene type protein-coding
Map location 21q11.2
Pascal p-value 4.662E-4
Sherlock p-value 0.53
Fetal beta -0.064
eGene Putamen basal ganglia
Support CompositeSet
Darnell FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DNM:Girard_2011 Whole Exome Sequencing analysis The data set included 15 DNMs found from the exomes of 14 schizophrenia probands and their parents.
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@DNM table

Gene Chromosome Position Ref Alt Transcript AA change Mutation type Sift CG46 Trait Study
NRIP1 chr21 16338349 T G NM_003489 p.722K>T missense Schizophrenia DNM:Girard_2011

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs2822746 21 15899364 NRIP1 ENSG00000180530.5 1.06941E-6 0.01 537957 gtex_brain_putamen_basal

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005102 receptor binding IEA Neurotransmitter (GO term level: 4) -
GO:0003713 transcription coactivator activity IDA 7641693|10364267|11518808
GO:0003713 transcription coactivator activity NAS 15572661
GO:0003714 transcription corepressor activity IDA 10364267
GO:0042826 histone deacetylase binding IEA -
GO:0035257 nuclear hormone receptor binding 新闻学会 11518808
去:0030331 estrogen receptor binding 新闻学会 7641693
GO:0035259 glucocorticoid receptor binding 新闻学会 10364267|11266503|12773562
GO:0050681 androgen receptor binding NAS 15572661
GO:0046965 retinoid X receptor binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0000122 negative regulation of transcription from RNA polymerase II promoter IDA 10364267
GO:0001543 ovarian follicle rupture IEA -
GO:0006350 transcription IEA -
去:0019915 sequestering of lipid IEA -
GO:0030728 ovulation IEA -
GO:0030521 androgen receptor signaling pathway NAS 15572661
GO:0045944 及功率tive regulation of transcription from RNA polymerase II promoter IDA 7641693|10364267
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0000118 histone deacetylase complex IEA -
GO:0005634 nucleus IDA 7641693|11266503|12773562

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
AHR - aryl hydrocarbon receptor - HPRD,BioGRID 10428779
CCDC85B DIPA coiled-coil domain containing 85B Two-hybrid BioGRID 16189514
CEP70 BITE | FLJ13036 centrosomal protein 70kDa Two-hybrid BioGRID 16189514
CTBP1 BARS | MGC104684 C-terminal binding protein 1 Reconstituted Complex BioGRID 15060175
CTBP1 BARS | MGC104684 C-terminal binding protein 1 - HPRD 11509661
CTBP2 - C-terminal binding protein 2 Reconstituted Complex
Two-hybrid		 BioGRID 15060175|16189514
ESR1 ER DKFZp686N23123 | | ESR |将有关| |时代NR3A1 estrogen receptor 1 ESR1 (ER-alpha) interacts with NRIP1 (RIP140). This interaction was modelled on a demonstrated interaction between human ESR1 and mouse NRIP1. BIND 9774463
ESR1 ER DKFZp686N23123 | | ESR |将有关| |时代NR3A1 estrogen receptor 1 ER interacts with NRIP-1 enhancer. BIND 16009131
ESR1 ER DKFZp686N23123 | | ESR |将有关| |时代NR3A1 estrogen receptor 1 - HPRD,BioGRID 7641693
FOXA1 HNF3A | MGC33105 | TCF3A forkhead box A1 FOXA1 interacts with NRIP-1 enhancer. BIND 16009131
HDAC1 DKFZp686H12203 | GON-10 | HD1 | RPD3 | RPD3L1 histone deacetylase 1 - HPRD 11006275|11285237
HDAC5 FLJ90614 | HD5 | NY-CO-9 histone deacetylase 5 Co-localization
Reconstituted Complex		 BioGRID 15060175
HDAC9 DKFZp779K1053 | HD7 | HDAC | HDAC7 | HDAC7B | HDAC9B | HDAC9FL | HDRP | KIAA0744 | MITR histone deacetylase 9 Reconstituted Complex BioGRID 15060175
JUN AP-1 | AP1 | c-Jun jun oncogene - HPRD,BioGRID 12554755
KAT2B CAF | P | P/CAF | PCAF K(lysine) acetyltransferase 2B - HPRD 14581481
LDOC1 BCUR1 | Mar7 | Mart7 leucine zipper, down-regulated in cancer 1 Two-hybrid BioGRID 16189514
MAP3K7 TAK1 | TGF1a mitogen-activated protein kinase kinase kinase 7 - HPRD 9556573
NR0B1 AHC | AHCH | AHX | DAX-1 | DAX1 | DSS | GTD | HHG | NROB1 nuclear receptor subfamily 0, group B, member 1 Reconstituted Complex
Two-hybrid		 BioGRID 11459805
NR1H3 LXR-a | LXRA | RLD-1 nuclear receptor subfamily 1, group H, member 3 - HPRD 10022764
NR2C1 TR2 nuclear receptor subfamily 2, group C, member 1 - HPRD 9774688
NR3C1 GCCR | GCR | GR | GRL nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor) Affinity Capture-Western
Reconstituted Complex		 BioGRID 10364267|11266503
|12773562
NR3C1 GCCR | GCR | GR | GRL nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor) - HPRD 10364267|12773562
NR5A1 AD4BP | ELP | FTZ1 | FTZF1 | SF-1 | SF1 nuclear receptor subfamily 5, group A, member 1 - HPRD,BioGRID 11459805|12782406
POLR2A MGC75453 | POLR2 | POLRA | RPB1 | RPBh1 | RPO2 | RPOL2 | RpIILS | hRPB220 | hsRPB1 polymerase (RNA) II (DNA directed) polypeptide A, 220kDa Pol II interacts with NRIP-1 enhancer. BIND 16009131
PPARA MGC2237 | MGC2452 | NR1C1 | PPAR | hPPAR peroxisome proliferator-activated receptor alpha - HPRD,BioGRID 9626662|10022764
PPARG NR1C3 | PPARG1 | PPARG2 | PPARgamma peroxisome proliferator-activated receptor gamma - HPRD,BioGRID 9626662
RARA NR1B1 | RAR retinoic acid receptor, alpha Affinity Capture-Western
Reconstituted Complex		 BioGRID 8887632|12549917
|14581481
RARA NR1B1 | RAR retinoic acid receptor, alpha - HPRD 12403842|12549917
RXRA FLJ00280 | FLJ00318 | FLJ16020 | FLJ16733 | MGC102720 | NR2B1 retinoid X receptor, alpha - HPRD,BioGRID 8887632
RXRB DAUDI6 | H-2RIIBP | MGC1831 | NR2B2 | RCoR-1 retinoid X receptor, beta - HPRD 12403842|12549917
RXRB DAUDI6 | H-2RIIBP | MGC1831 | NR2B2 | RCoR-1 retinoid X receptor, beta Reconstituted Complex BioGRID 9626662
TEX11 TGC1 | TSGA3 testis expressed 11 Two-hybrid BioGRID 16189514
THRA AR7 | EAR7 | ERB-T-1 | ERBA | ERBA1 | MGC000261 | MGC43240 | NR1A1 | THRA1 | THRA2 | c-ERBA-1 thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian) Reconstituted Complex BioGRID 9626662
TNFRSF14 ATAR | HVEA | HVEM | LIGHTR | TR2 tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) - HPRD 9774688
TRAF2 MGC:45012 | TRAP | TRAP3 TNF receptor-associated factor 2 Two-hybrid BioGRID 16189514
YWHAH YWHA1 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide - HPRD 11266503
YWHAQ 14-3-3 | 1C5 | HS1 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide Co-localization
Phenotypic Suppression
Reconstituted Complex		 BioGRID 11266503


Section V. Pathway annotation

Pathway name Pathway size #年代ZGR 2.0 genes in pathway Info
BIOCARTA CARM ER PATHWAY 35 27 All SZGR 2.0 genes in this pathway
BIOCARTA PPARA PATHWAY 58 43 All SZGR 2.0 genes in this pathway
PID基于“增大化现实”技术的途径 61 46 All SZGR 2.0 genes in this pathway
PID ERA GENOMIC PATHWAY 65 37 All SZGR 2.0 genes in this pathway
PID RETINOIC ACID PATHWAY 30 23 All SZGR 2.0 genes in this pathway
PID HNF3A PATHWAY 44 29 All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA DN 526 357 All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN 463 290 All SZGR 2.0 genes in this pathway
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN 663 425 All SZGR 2.0 genes in this pathway
HUTTMANN B CLL POOR SURVIVAL DN 60 39 All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS UP 372 227 All SZGR 2.0 genes in this pathway
WANG CLIM2 TARGETS UP 269 146 All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER UP 404 246 All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION ERYTHROCYTE UP 157 104 All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL UP 146 99 All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL UP 316 190 All SZGR 2.0 genes in this pathway
GRAHAM CML DIVIDING VS NORMAL QUIESCENT DN 95 57 All SZGR 2.0 genes in this pathway
GRAHAM NORMAL QUIESCENT VS NORMAL DIVIDING UP 66 47 All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER UP 443 294 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 3 4WK DN 39 27 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 5 6WK DN 137 97 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 6 7WK UP 197 135 All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP 584 356 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL TGFB1 TARGETS UP 169 127 All SZGR 2.0 genes in this pathway
MCBRYAN TERMINAL END BUD DN 7 6 All SZGR 2.0 genes in this pathway
MARTIN INTERACT WITH HDAC 44 31 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN 855 609 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN 483 336 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN 514 330 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP 487 286 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT AND CANCER BOX4 DN 32 22 All SZGR 2.0 genes in this pathway
FRASOR RESPONSE TO ESTRADIOL UP 37 28 All SZGR 2.0 genes in this pathway
BECKER TAMOXIFEN RESISTANCE UP 50 36 All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP 555 346 All SZGR 2.0 genes in this pathway
HASLINGER B CLL WITH MUTATED VH GENES 18 14 All SZGR 2.0 genes in this pathway
WANG IMMORTALIZED BY HOXA9 AND MEIS1 DN 24 15 All SZGR 2.0 genes in this pathway
STOSSI RESPONSE TO ESTRADIOL 50 35 All SZGR 2.0 genes in this pathway
FERRANDO T ALL WITH MLL ENL FUSION UP 87 67 All SZGR 2.0 genes in this pathway
BROWN MYELOID CELL DEVELOPMENT DN 129 86 All SZGR 2.0 genes in this pathway
ROETH TERT TARGETS UP 14 11 All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA MS UP 48 32 All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP 314 201 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237 837 All SZGR 2.0 genes in this pathway
RUAN RESPONSE TO TNF TROGLITAZONE DN 42 24 All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C2 54 39 All SZGR 2.0 genes in this pathway
RUAN RESPONSE TO TNF DN 84 50 All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 5 126 78 All SZGR 2.0 genes in this pathway
GENTILE UV RESPONSE CLUSTER D2 41 30 All SZGR 2.0 genes in this pathway
GENTILE UV HIGH DOSE DN 312 203 All SZGR 2.0 genes in this pathway
GEORGANTAS HSC MARKERS 71 47 All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN 318 220 All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS UP 280 183 All SZGR 2.0 genes in this pathway
DURCHDEWALD SKIN CARCINOGENESIS DN 264 168 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 528 324 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4 307 185 All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER T4 94 69 All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3 491 310 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED 1022 619 All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN T LYMPHOCYTE DN 37 29 All SZGR 2.0 genes in this pathway
STEARMAN LUNG CANCER EARLY VS LATE UP 125 89 All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE DN 258 160 All SZGR 2.0 genes in this pathway
MASSARWEH RESPONSE TO ESTRADIOL 61 47 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BRAIN DN 85 58 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN 701 446 All SZGR 2.0 genes in this pathway
IZADPANAH STEM CELL ADIPOSE VS BONE DN 108 68 All SZGR 2.0 genes in this pathway
BOCHKIS FOXA2 TARGETS 425 261 All SZGR 2.0 genes in this pathway
MATZUK OVULATION 14 10 All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL CULTURED VS FRESH UP 425 298 All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB DN 342 220 All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C CLUSTER DN 32 21 All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C DN 59 39 All SZGR 2.0 genes in this pathway
FERRARI RESPONSE TO FENRETINIDE UP 22 16 All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 12 30 20 All SZGR 2.0 genes in this pathway
MARSON FOXP3 TARGETS UP 66 43 All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA PCA3 UP 80 54 All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE 721 492 All SZGR 2.0 genes in this pathway
RUAN RESPONSE TO TROGLITAZONE DN 19 14 All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP 548 370 All SZGR 2.0 genes in this pathway
HOELZEL NF1 TARGETS UP 139 93 All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 6HR UP 229 149 All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR UP 324 193 All SZGR 2.0 genes in this pathway
CERIBELLI GENES INACTIVE AND BOUND BY NFY 45 27 All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN 229 135 All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS DN 553 343 All SZGR 2.0 genes in this pathway
IKEDA MIR30 TARGETS UP 116 87 All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF 516 308 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-103/107 2969 2975 1A hsa-miR-103brain AGCAGCAUUGUACAGGGCUAUGA
hsa-miR-107brain AGCAGCAUUGUACAGGGCUAUCA
miR-125/351 2238 2244 1A hsa-miR-125bbrain UCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrain UCCCUGAGACCCUUUAACCUGUG
miR-128 244 250 1A hsa-miR-128a UCACAGUGAACCGGUCUCUUUU
hsa-miR-128b UCACAGUGAACCGGUCUCUUUC
miR-143 1308 1314 1A hsa-miR-143brain UGAGAUGAAGCACUGUAGCUCA
miR-186 622 628 1A hsa-miR-186 CAAAGAAUUCUCCUUUUGGGCUU
miR-192/215 2234 2240 m8 hsa-miR-192 CUGACCUAUGAAUUGACAGCC
hsa-miR-215 AUGACCUAUGAAUUGACAGAC
miR-193 2039 2045 m8 hsa-miR-193a AACUGGCCUACAAAGUCCCAG
hsa-miR-193b AACUGGCCCUCAAAGUCCCGCUUU
miR-194 2726 2732 1A hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
miR-200bc/429 3060 3066 m8 hsa-miR-200b UAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200c UAAUACUGCCGGGUAAUGAUGG
hsa-miR-429 UAAUACUGUCUGGUAAAACCGU
miR-208 3022 3028 1A hsa-miR-208 AUAAGACGAGCAAAAAGCUUGU
miR-214 2967 2973 m8 hsa-miR-214brain ACAGCAGGCACAGACAGGCAG
miR-219 2076 2082 m8 hsa-miR-219brain UGAUUGUCCAAACGCAAUUCU
miR-25/32/92/363/367 1201 1207 1A hsa-miR-25brain CAUUGCACUUGUCUCGGUCUGA
hsa-miR-32 UAUUGCACAUUACUAAGUUGC
hsa-miR-92 UAUUGCACUUGUCCCGGCCUG
hsa-miR-367 AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZ UAUUGCACUCGUCCCGGCCUC
miR-26 1842 1849 1A,m8 hsa-miR-26abrain UUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZ UUCAAGUAAUUCAGGAUAGGUU
miR-27 244 250 m8 hsa-miR-27abrain UUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrain UUCACAGUGGCUAAGUUCUGC
miR-30-5p 3292 3299 1A,m8 hsa-miR-30a-5p UGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrain UGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZ UGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZ UGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5p UGUAAACAUCCUUGACUGGA
hsa-miR-30a-5p UGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrain UGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZ UGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZ UGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5p UGUAAACAUCCUUGACUGGA
miR-324-3p 3445 3451 1A hsa-miR-324-3p CCACUGCCCCAGGUGCUGCUGG
miR-328 1385 1391 m8 hsa-miR-328brain CUGGCCCUCUCUGCCCUUCCGU
miR-33 2812 2818 1A hsa-miR-33 GUGCAUUGUAGUUGCAUUG
hsa-miR-33b GUGCAUUGCUGUUGCAUUGCA
miR-377 3397 3403 1A hsa-miR-377 AUCACACAAAGGCAACUUUUGU
miR-378 1312 1318 1A hsa-miR-378 CUCCUGACUCCAGGUCCUGUGU
miR-380-5p 3151 3158 1A,m8 hsa-miR-380-5p UGGUUGACCAUAGAACAUGCGC
hsa-miR-563 AGGUUGACAUACGUUUCCC
miR-448 149 155 m8 hsa-miR-448 UUGCAUAUGUAGGAUGUCCCAU
miR-488 1296 1302 m8 hsa-miR-488 CCCAGAUAAUGGCACUCUCAA
miR-490 1769 1776 1A,m8 hsa-miR-490 CAACCUGGAGGACUCCAUGCUG
miR-496 2763 2769 1A hsa-miR-496 AUUACAUGGCCAAUCUC
miR-499 3022 3028 1A hsa-miR-499 UUAAGACUUGCAGUGAUGUUUAA