Gene Page:TCF7L1
Summary?
GeneID | 83439 |
Symbol | TCF7L1 |
Synonyms | TCF-3|TCF3 |
Description | transcription factor 7 like 1 |
Reference | MIM:604652|HGNC:HGNC:11640|Ensembl:ENSG00000152284|HPRD:06874|Vega:OTTHUMG00000130026 |
Gene type | protein-coding |
Map location | 2p11.2 |
Pascal p-value | 0.15 |
Sherlock p-value | 0.727 |
Fetal beta | 0.385 |
DMG | 2 (# studies) |
eGene | Cerebellum Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 3 |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 3 |
GSMA_I | Genome scan meta-analysis | Psr: 0.0004 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg21541159 | 2 | 85476431 | TCF7L1 | 3.261E-4 | 0.362 | 0.04 | DMG:Wockner_2014 |
cg04593571 | 2 | 85361052 | TCF7L1 | 3.346E-4 | -0.269 | 0.041 | DMG:Wockner_2014 |
cg02508567 | 2 | 85361184 | TCF7L1 | -0.034 | 0.43 | DMG:Nishioka_2013 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs4501739 | chrX | 35960848 | TCF7L1 | 83439 | 0.02 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ADPRHL2 | 0.84 | 0.82 |
MED22 | 0.82 | 0.76 |
PTOV1 | 0.81 | 0.78 |
SLC35B2 | 0.81 | 0.78 |
C2orf24 | 0.81 | 0.79 |
MAF1 | 0.80 | 0.76 |
ZFPL1 | 0.80 | 0.78 |
COBRA1 | 0.80 | 0.78 |
XKR8 | 0.79 | 0.76 |
TSSC4 | 0.79 | 0.76 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.27 | -0.60 | -0.67 |
MT-CO2 | -0.58 | -0.66 |
AF347015.8 | -0.58 | -0.67 |
AF347015.31 | -0.58 | -0.65 |
AF347015.33 | -0.57 | -0.64 |
AF347015.21 | -0.57 | -0.72 |
MT-CYB | -0.56 | -0.65 |
AF347015.15 | -0.55 | -0.65 |
C5orf53 | -0.53 | -0.54 |
MT-ATP8 | -0.53 | -0.72 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | NAS | 1741298|11085512 | |
GO:0008013 | beta-catenin binding | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0006350 | transcription | IEA | - | |
GO:0048319 | axial mesoderm morphogenesis | IEA | - | |
GO:0006325 | establishment or maintenance of chromatin architecture | NAS | 1741298|11085512 | |
GO:0030111 | regulation of Wnt receptor signaling pathway | NAS | 1741298|11085512 | |
GO:0008595 | determination of anterior/posterior axis, embryo | IEA | - | |
GO:0048863 | stem cell differentiation | IEA | - | |
GO:0045892 | negative regulation of transcription, DNA-dependent | IEA | - | |
GO:0046022 | positive regulation of transcription from RNA polymerase II promoter, mitotic | IEA | - | |
细胞混合涂料nent | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | NAS | 1741298|11085512 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG WNT SIGNALING PATHWAY | 151 | 112 | All SZGR 2.0 genes in this pathway |
KEGG ADHERENS JUNCTION | 75 | 53 | All SZGR 2.0 genes in this pathway |
KEGG MELANOGENESIS | 102 | 80 | All SZGR 2.0 genes in this pathway |
KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
KEGG COLORECTAL CANCER | 62 | 47 | All SZGR 2.0 genes in this pathway |
KEGG ENDOMETRIAL CANCER | 52 | 45 | All SZGR 2.0 genes in this pathway |
KEGG PROSTATE CANCER | 89 | 75 | All SZGR 2.0 genes in this pathway |
KEGG THYROID CANCER | 29 | 26 | All SZGR 2.0 genes in this pathway |
KEGG BASAL CELL CARCINOMA | 55 | 44 | All SZGR 2.0 genes in this pathway |
KEGG ACUTE MYELOID LEUKEMIA | 60 | 47 | All SZGR 2.0 genes in this pathway |
KEGG ARRHYTHMOGENIC RIGHT VENTRICULAR CARDIOMYOPATHY ARVC | 76 | 59 | All SZGR 2.0 genes in this pathway |
WNT SIGNALING | 89 | 71 | All SZGR 2.0 genes in this pathway |
PID BETA CATENIN NUC PATHWAY | 80 | 60 | All SZGR 2.0 genes in this pathway |
PID DELTA NP63 PATHWAY | 47 | 34 | All SZGR 2.0 genes in this pathway |
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP | 255 | 177 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS DN | 142 | 95 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA DN | 394 | 258 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER BASAL VS LULMINAL | 330 | 215 | All SZGR 2.0 genes in this pathway |
GROSS ELK3 TARGETS UP | 27 | 16 | All SZGR 2.0 genes in this pathway |
GROSS HIF1A TARGETS UP | 8 | 5 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
KOYAMA SEMA3B TARGETS DN | 411 | 249 | All SZGR 2.0 genes in this pathway |
BENPORATH ES 1 | 379 | 235 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH OCT4 TARGETS | 290 | 172 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
BENPORATH NOS TARGETS | 179 | 105 | All SZGR 2.0 genes in this pathway |
BENPORATH ES CORE NINE CORRELATED | 100 | 68 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
MANALO HYPOXIA UP | 207 | 145 | All SZGR 2.0 genes in this pathway |
MATSUDA NATURAL KILLER DIFFERENTIATION | 475 | 313 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL LONG TERM | 302 | 191 | All SZGR 2.0 genes in this pathway |
DELASERNA MYOD TARGETS DN | 57 | 42 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
NIKOLSKY OVERCONNECTED IN BREAST CANCER | 22 | 19 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
乳腺癌萧述三腔的DN | 564 | 326 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
BHATI G2M ARREST BY 2METHOXYESTRADIOL DN | 127 | 75 | All SZGR 2.0 genes in this pathway |
WONG EMBRYONIC STEM CELL CORE | 335 | 193 | All SZGR 2.0 genes in this pathway |
NIELSEN MALIGNAT FIBROUS HISTIOCYTOMA DN | 18 | 11 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
BAKKER FOXO3 TARGETS DN | 187 | 109 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
RAO受SALL4同种型B | 517 | 302 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
DURAND STROMA S UP | 297 | 194 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-132/212 | 103 | 109 | m8 | hsa-miR-212SZ | UAACAGUCUCCAGUCACGGCC |
hsa-miR-132brain | UAACAGUCUACAGCCAUGGUCG | ||||
miR-204/211 | 619 | 625 | m8 | hsa-miR-204brain | UUCCCUUUGUCAUCCUAUGCCU |
hsa-miR-211 | UUCCCUUUGUCAUCCUUCGCCU | ||||
miR-30-3p | 229 | 236 | 1A,m8 | hsa-miR-30a-3p | CUUUCAGUCGGAUGUUUGCAGC |
hsa-miR-30e-3p | CUUUCAGUCGGAUGUUUACAGC | ||||
miR-329 | 828 | 834 | 1A | hsa-miR-329brain | AACACACCUGGUUAACCUCUUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.