Gene Page:PIP5K1A

Summary?
GeneID 8394
Symbol PIP5K1A
Synonyms -
Description phosphatidylinositol-4-phosphate 5-kinase, type I, alpha
Reference MIM:603275|HGNC:HGNC:8994|Ensembl:ENSG00000143398|Vega:OTTHUMG00000012351
Gene type protein-coding
Map location 1q21.3
Sherlock p-value 0.142
Fetal beta 0.759
DMG 2 (# studies)
eGene Caudate basal ganglia
Cerebellar Hemisphere
Cerebellum
Nucleus accumbens basal ganglia
Putamen basal ganglia
Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Nishioka_2013 Genome-wide DNA methylation analysis The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. 2
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 2
GSMA_I Genome scan meta-analysis Psr: 0.0235
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.00814

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg09166705 1 151170883 PIP5K1A 4.46E-5 -0.493 0.021 DMG:Wockner_2014
cg20854748 1 151170914 PIP5K1A -0.025 0.27 DMG:Nishioka_2013

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs17055195 chr3 55369565 PIP5K1A 8394 0.17 trans
rs17055216 chr3 55381947 PIP5K1A 8394 0.17 trans
rs17055218 chr3 55382206 PIP5K1A 8394 0.17 trans
rs17055224 chr3 55383487 PIP5K1A 8394 0.17 trans
rs17055232 chr3 55385671 PIP5K1A 8394 0.17 trans
rs17055233 chr3 55385691 PIP5K1A 8394 0.17 trans
rs6445730 chr3 55386217 PIP5K1A 8394 0.17 trans
rs747266 chr3 55387379 PIP5K1A 8394 0.17 trans
rs3811402 1 151119745 PIP5K1A ENSG00000143398.15 4.55127E-6 0.03 -50680 gtex_brain_putamen_basal

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26conception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
SEL1L 0.94 0.96
NF1 0.94 0.95
C11orf41 0.94 0.95
MTOR 0.93 0.96
MGAT5 0.93 0.96
PLEKHM3 0.93 0.96
ASH1L 0.93 0.94
UBE4A 0.93 0.95
MEGF9 0.93 0.95
PIKFYVE 0.93 0.94
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.31 -0.66 -0.70
FXYD1 -0.66 -0.68
AF347015.21 -0.66 -0.73
HIGD1B -0.65 -0.71
C1orf54 -0.65 -0.78
MT-CO2 -0.64 -0.69
ENHO -0.63 -0.69
SAT1 -0.63 -0.70
S100A16 -0.62 -0.66
TLCD1 -0.62 -0.65

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0016740 transferase activity IEA -
GO:0016308 1-phosphatidylinositol-4-phosphate 5-kinase activity NAS -
GO:0016301 kinase activity IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007165 signal transduction TAS 8955136
GO:0006650 glycerophospholipid metabolic process TAS 8955136
GO:0016310 phosphorylation NAS -
GO:0046488 phosphatidylinositol metabolic process IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0012505 endomembranesystem IEA -
GO:0005794 Golgi apparatus IEA -
GO:0005575 cellular_component ND -
GO:0005886 plasma membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG INOSITOL PHOSPHATE METABOLISM 54 42 All SZGR 2.0 genes in this pathway
KEGG PHOSPHATIDYLINOSITOL SIGNALING SYSTEM 76 56 All SZGR 2.0 genes in this pathway
KEGG ENDOCYTOSIS 183 132 All SZGR 2.0 genes in this pathway
KEGG FC GAMMA R MEDIATED PHAGOCYTOSIS 97 71 All SZGR 2.0 genes in this pathway
KEGG REGULATION OF ACTIN CYTOSKELETON 216 144 All SZGR 2.0 genes in this pathway
BIOCARTA RHO PATHWAY 32 23 All SZGR 2.0 genes in this pathway
PID RHOA PATHWAY 45 33 All SZGR 2.0 genes in this pathway
PID AVB3 OPN PATHWAY 31 29 All SZGR 2.0 genes in this pathway
PID ARF6 DOWNSTREAM PATHWAY 15 14 All SZGR 2.0 genes in this pathway
PID ECADHERIN KERATINOCYTE PATHWAY 21 19 All SZGR 2.0 genes in this pathway
PID ARF 3PATHWAY 19 13 All SZGR 2.0 genes in this pathway
PID RAC1 PATHWAY 54 37 All SZGR 2.0 genes in this pathway
DOANE RESPONSE TO ANDROGEN UP 184 125 All SZGR 2.0 genes in this pathway
RODRIGUES NTN1 TARGETS DN 158 102 All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS DN 352 225 All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN 335 193 All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS UP 457 269 All SZGR 2.0 genes in this pathway
SENESE HDAC3目标了 501 327 All SZGR 2.0 genes in this pathway
NAGASHIMA NRG1 SIGNALING DN 58 35 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN 855 609 All SZGR 2.0 genes in this pathway
YANAGIHARA ESX1 TARGETS 30 19 All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN 848 527 All SZGR 2.0 genes in this pathway
LOCKWOOD AMPLIFIED IN LUNG CANCER 214 139 All SZGR 2.0 genes in this pathway
WEI MIR34A TARGETS 148 97 All SZGR 2.0 genes in this pathway
AMIT EGF RESPONSE 40 HELA 42 29 All SZGR 2.0 genes in this pathway
AMIT SERUM RESPONSE 60 MCF10A 57 42 All SZGR 2.0 genes in this pathway
HANSON HRAS SIGNALING VIA NFKB 22 14 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 16HR UP 225 139 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 1691 1088 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR UP 180 125 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED 1022 619 All SZGR 2.0 genes in this pathway
SANSOM APC MYC TARGETS 217 138 All SZGR 2.0 genes in this pathway
HELLER SILENCED BY METHYLATION UP 282 183 All SZGR 2.0 genes in this pathway
LIN MELANOMA COPY NUMBER UP 73 53 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN 543 317 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP 602 364 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP 601 369 All SZGR 2.0 genes in this pathway
IZADPANAH STEM CELL ADIPOSE VS BONE DN 108 68 All SZGR 2.0 genes in this pathway
SASAI TARGETS OF CXCR6 AND PTCH1 DN 8 6 All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP 397 206 All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3 824 528 All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF 516 308 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

microrna的家庭 Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-34/449 839 846 1A,m8 hsa-miR-34abrain UGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34c AGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449 UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC