Gene Page:TOMM40L

Summary?
GeneID 84134
Symbol TOMM40L
Synonyms TOMM40B
Description translocase of outer mitochondrial membrane 40 like
Reference HGNC:HGNC:25756|Ensembl:ENSG00000158882|HPRD:13354|Vega:OTTHUMG00000034345
Gene type protein-coding
Map location 1q23.3
Sherlock p-value 0.045
Support Ascano FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.00814

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0003677 DNA binding IEA -
GO:0005515 protein binding IEA -
GO:0008308 电压门控离子通道活动ty IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0006820 anion transport IEA -
GO:0016481 negative regulation of transcription IEA -
GO:0015031 protein transport IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005829 cytosol IEA -
GO:0005634 nucleus IEA -
GO:0005739 mitochondrion IEA -
GO:0005741 mitochondrial outer membrane IEA -
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -
GO:0043234 protein complex IDA 11256614

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG AMYOTROPHIC LATERAL SCLEROSIS ALS 53 43 All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS 988 594 All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION DN 517 309 All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE UP 578 341 All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3 718 401 All SZGR 2.0 genes in this pathway
MIKKELSEN NPC ICP WITH H3K4ME3 445 257 All SZGR 2.0 genes in this pathway
ZWANG EGF INTERVAL DN 214 124 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-346 735 742 1A,m8 hsa-miR-346brain UGUCUGCCCGCAUGCCUGCCUCU
miR-378 1438 1444 1A hsa-miR-378 CUCCUGACUCCAGGUCCUGUGU