Gene Page:PSD2

Summary?
GeneID 84249
Symbol PSD2
Synonyms EFA6C
Description pleckstrin and Sec7 domain containing 2
Reference HGNC:HGNC:19092|Ensembl:ENSG00000146005|HPRD:15190|Vega:OTTHUMG00000129240
Gene type protein-coding
Map location 5q31.2
Pascal p-value 0.056
Sherlock p-value 0.427
Fetal beta 0.047
DMG 3 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 3
DMG:Nishioka_2013 Genome-wide DNA methylation analysis The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. 3
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 3
GSMA_I Genome scan meta-analysis Psr: 0.0032
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg22519912 5 139187370 PSD2 2.446E-4 0.487 0.037 DMG:Wockner_2014
cg17811228 5 139175116 PSD2 -0.025 0.25 DMG:Nishioka_2013
cg00885708 5 139167076 PSD2 7.43E-9 -0.017 3.68E-6 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005086 ARF guanyl-nucleotide exchange factor activity IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0032012 regulation of ARF protein signal transduction IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0043025 cell soma IEA axon, dendrite (GO term level: 4) -
GO:0030425 dendrite IEA neuron, axon, dendrite (GO term level: 6) -
GO:0005622 intracellular IEA -
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG ENDOCYTOSIS 183 132 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
ZHENG GLIOBLASTOMA PLASTICITY DN 58 39 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3 UNMETHYLATED 536 296 All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3 435 318 All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN 306 191 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590 403 All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP 489 314 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-138 435 441 1A hsa-miR-138brain AGCUGGUGUUGUGAAUC
miR-218 55 61 1A hsa-miR-218brain UUGUGCUUGAUCUAACCAUGU
miR-370 440 446 m8 hsa-miR-370brain GCCUGCUGGGGUGGAACCUGG