Gene Page:BRSK1
Summary?
GeneID | 84446 |
Symbol | BRSK1 |
Synonyms | hSAD1 |
Description | BR serine/threonine kinase 1 |
Reference | MIM:609235|HGNC:HGNC:18994|Ensembl:ENSG00000160469|HPRD:12533|Vega:OTTHUMG00000180735 |
Gene type | protein-coding |
Map location | 19q13.4 |
Pascal p-value | 0.451 |
Sherlock p-value | 0.86 |
TADA p-value | 0.016 |
Fetal beta | -0.126 |
Support | INTRACELLULAR SIGNAL TRANSDUCTION G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
BRSK1 | chr19 | 55798375 | G | A | NM_032430 NM_032430 |
. p.46G>E |
splice-acceptor-ex1g missense |
Schizophrenia | DNM:Fromer_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/BRSK1_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0000287 | magnesium ion binding | IDA | 14976552 | |
GO:0005524 | ATP binding | IC | 15150265 | |
GO:0004674 | protein serine/threonine kinase activity | IDA | 15150265 | |
GO:0016740 | transferase activity | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0030182 | neuron differentiation | ISS | neuron (GO term level: 8) | - |
GO:0006468 | protein amino acid phosphorylation | IDA | 15150265 | |
GO:0030010 | establishment of cell polarity | ISS | - | |
GO:0010212 | response to ionizing radiation | IDA | 15150265 | |
GO:0009411 | response to UV | IDA | 15150265 | |
GO:0006974 | response to DNA damage stimulus | IDA | 15150265 | |
GO:0031572 | G2/M transition DNA damage checkpoint | IDA | 15150265 | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IDA | 15150265 | |
GO:0005737 | cytoplasm | IDA | 15150265 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID LKB1 PATHWAY | 47 | 37 | All SZGR 2.0 genes in this pathway |
HAMAI APOPTOSIS VIA TRAIL DN | 186 | 107 | All SZGR 2.0 genes in this pathway |
MANTOVANI NFKB TARGETS DN | 11 | 6 | All SZGR 2.0 genes in this pathway |
MANTOVANI VIRAL GPCR SIGNALING DN | 49 | 37 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA MF DN | 41 | 28 | All SZGR 2.0 genes in this pathway |
MIKKELSEN ES ICP WITH H3K4ME3 | 718 | 401 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC ICP WITH H3K4ME3 | 445 | 257 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
DELACROIX RAR BOUND ES | 462 | 273 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-128 | 57 | 63 | 1A | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-27 | 57 | 64 | 1A,m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.