Gene Page:L3MBTL3

Summary?
GeneID 84456
Symbol L3MBTL3
Synonyms MBT-1|MBT1
Description l(3)mbt-like 3 (Drosophila)
Reference HGNC:HGNC:23035|Ensembl:ENSG00000198945|HPRD:11222|Vega:OTTHUMG00000015554
Gene type protein-coding
Map location 6q23
Pascal p-value 0.631
Sherlock p-value 0.704
Fetal beta 1.706
DMG 1 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg15801215 6 130341195 L3MBTL3 5.62E-8 -0.019 1.45E-5 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003674 molecular_function ND -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0045449 regulation of transcription IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus NAS -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN 514 330 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS EARLY PROGENITOR 532 309 All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3 491 310 All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN THYMUS UP 196 137 All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE UP 578 341 All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP 430 288 All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA D UP 89 62 All SZGR 2.0 genes in this pathway
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 UP 134 85 All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN 321 200 All SZGR 2.0 genes in this pathway
FOSTER KDM1A TARGETS UP 266 142 All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B 517 302 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-138 655 662 1A,m8 hsa-miR-138brain AGCUGGUGUUGUGAAUC
miR-17-5p/20/93.mr/106/519.d 1218 1225 1A,m8 hsa-miR-17-5p CAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrain UAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106a AAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZ UAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZ CAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUGU
miR-183 487 494 1A,m8 hsa-miR-183 UAUGGCACUGGUAGAAUUCACUG
miR-19 618 624 m8 hsa-miR-19a UGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
miR-218 57 64 1A,m8 hsa-miR-218brain UUGUGCUUGAUCUAACCAUGU
miR-410 400 406 1A hsa-miR-410 AAUAUAACACAGAUGGCCUGU