Gene Page:RAB2B

Summary?
GeneID 84932
Symbol RAB2B
Synonyms -
Description RAB2B, member RAS oncogene family
Reference MIM:607466|HGNC:HGNC:20246|Ensembl:ENSG00000129472|HPRD:06312|Vega:OTTHUMG00000029693
Gene type protein-coding
Map location 14q11.2
Pascal p-value 0.242
Sherlock p-value 0.217
Fetal beta 0.8
DMG 2 (# studies)
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 2
DMG:Nishioka_2013 Genome-wide DNA methylation analysis The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. 2
GSMA_I Genome scan meta-analysis Psr: 0.047
Expression Meta-analysis of gene expression Pvalue: 2.165

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg11053740 14 21945175 RAB2B -0.023 0.27 DMG:Nishioka_2013
cg11810906 14 21924453 RAB2B 3.9E-10 -0.012 7.56E-7 DMG:Jaffe_2016

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs7339413 chr13 62125219 RAB2B 84932 0.19 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconceptionweeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0005524 ATP binding IEA -
GO:0005525 GTP binding IEA -
GO:0008134 transcription factor binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006355 regulation of transcription, DNA-dependent IEA -
GO:0007264 small GTPase mediated signal transduction IEA -
GO:0016192 vesicle-mediated transport IEA -
GO:0015031 protein transport IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0000139 Golgi membrane IEA -
GO:0005794 Golgi apparatus IEA -
GO:0005789 endoplasmic reticulum membrane IEA -
GO:0005622 intracellular IEA -
GO:0005783 endoplasmic reticulum IEA -
GO:0005886 plasma membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
DARWICHE SKIN TUMOR PROMOTER UP 142 96 All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK LOW DN 165 107 All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK HIGH UP 147 101 All SZGR 2.0 genes in this pathway
DARWICHE SQUAMOUS CELL CARCINOMA UP 146 104 All SZGR 2.0 genes in this pathway
SHI SPARC TARGETS UP 24 17 All SZGR 2.0 genes in this pathway
ZHU CMV ALL UP 120 89 All SZGR 2.0 genes in this pathway
ZHU CMV 24 HR UP 93 65 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP 953 554 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP 783 442 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP 673 430 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP 602 364 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP 601 369 All SZGR 2.0 genes in this pathway
LIN NPAS4 TARGETS UP 163 100 All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN 1080 713 All SZGR 2.0 genes in this pathway
GOBERT CORE OLIGODENDROCYTE DIFFERENTIATION 40 28 All SZGR 2.0 genes in this pathway
PECE MAMMARY STEM CELL DN 146 88 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839 928 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-19 802 809 1A,m8 hsa-miR-19a UGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
miR-448 1552 1558 m8 hsa-miR-448 UUGCAUAUGUAGGAUGUCCCAU