Gene Page:RAB2B
Summary?
GeneID | 84932 |
Symbol | RAB2B |
Synonyms | - |
Description | RAB2B, member RAS oncogene family |
Reference | MIM:607466|HGNC:HGNC:20246|Ensembl:ENSG00000129472|HPRD:06312|Vega:OTTHUMG00000029693 |
Gene type | protein-coding |
Map location | 14q11.2 |
Pascal p-value | 0.242 |
Sherlock p-value | 0.217 |
Fetal beta | 0.8 |
DMG | 2 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 2 |
DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 2 |
GSMA_I | Genome scan meta-analysis | Psr: 0.047 | |
Expression | Meta-analysis of gene expression | Pvalue: 2.165 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg11053740 | 14 | 21945175 | RAB2B | -0.023 | 0.27 | DMG:Nishioka_2013 | |
cg11810906 | 14 | 21924453 | RAB2B | 3.9E-10 | -0.012 | 7.56E-7 | DMG:Jaffe_2016 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs7339413 | chr13 | 62125219 | RAB2B | 84932 | 0.19 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/RAB2B_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconceptionweeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0005524 | ATP binding | IEA | - | |
GO:0005525 | GTP binding | IEA | - | |
GO:0008134 | transcription factor binding | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0007264 | small GTPase mediated signal transduction | IEA | - | |
GO:0016192 | vesicle-mediated transport | IEA | - | |
GO:0015031 | protein transport | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0000139 | Golgi membrane | IEA | - | |
GO:0005794 | Golgi apparatus | IEA | - | |
GO:0005789 | endoplasmic reticulum membrane | IEA | - | |
GO:0005622 | intracellular | IEA | - | |
GO:0005783 | endoplasmic reticulum | IEA | - | |
GO:0005886 | plasma membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
DARWICHE SKIN TUMOR PROMOTER UP | 142 | 96 | All SZGR 2.0 genes in this pathway |
DARWICHE PAPILLOMA RISK LOW DN | 165 | 107 | All SZGR 2.0 genes in this pathway |
DARWICHE PAPILLOMA RISK HIGH UP | 147 | 101 | All SZGR 2.0 genes in this pathway |
DARWICHE SQUAMOUS CELL CARCINOMA UP | 146 | 104 | All SZGR 2.0 genes in this pathway |
SHI SPARC TARGETS UP | 24 | 17 | All SZGR 2.0 genes in this pathway |
ZHU CMV ALL UP | 120 | 89 | All SZGR 2.0 genes in this pathway |
ZHU CMV 24 HR UP | 93 | 65 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS UP | 602 | 364 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
LIN NPAS4 TARGETS UP | 163 | 100 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
GOBERT CORE OLIGODENDROCYTE DIFFERENTIATION | 40 | 28 | All SZGR 2.0 genes in this pathway |
PECE MAMMARY STEM CELL DN | 146 | 88 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-19 | 802 | 809 | 1A,m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-448 | 1552 | 1558 | m8 | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.