Gene Page:PPFIA2

Summary?
GeneID 8499
Symbol PPFIA2
Synonyms -
Description PTPRF interacting protein alpha 2
Reference MIM:603143|HGNC:HGNC:9246|Ensembl:ENSG00000139220|HPRD:04392|Vega:OTTHUMG00000170181
Gene type protein-coding
Map location 12q21.31
Pascal p-value 0.365
Fetal beta 0.168
eGene Caudate basal ganglia
Support PROTEIN CLUSTERING
G2Cdb.humanPSD
G2Cdb.humanPSP
CompositeSet
Potential synaptic genes

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWAScat Genome-wide Association Studies This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception凌晨ks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
MAPRE3 0.87 0.88
ATP6V0A1 0.87 0.88
WARS 0.86 0.85
BECN1 0.86 0.84
AARS 0.86 0.88
PDHX 0.86 0.83
DDX24 0.86 0.81
UQCC 0.85 0.85
PCMT1 0.85 0.87
NDEL1 0.85 0.85
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.21 -0.55 -0.30
AF347015.18 -0.54 -0.30
AP002478.3 -0.51 -0.44
AF347015.2 -0.51 -0.28
RAB34 -0.49 -0.53
AF347015.8 -0.47 -0.26
AF347015.31 -0.47 -0.30
IL32 -0.47 -0.29
MT-CO2 -0.46 -0.28
AC100783.1 -0.46 -0.34

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005515 protein binding 新闻学会 12923177
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007160 cell-matrix adhesion TAS 9624153
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0019717 synaptosome IEA Synap, Brain (GO term level: 7) -
GO:0005737 cytoplasm TAS 9624153
去:0009986 cell surface IEA -

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
ERC2 CAST | CAST1 | ELKSL | KIAA0378 | MGC133063 | MGC133064 | SPBC110 | Spc110 ELKS/RAB6-interacting/CAST family member 2 - HPRD,BioGRID 12923177
ERC2 CAST | CAST1 | ELKSL | KIAA0378 | MGC133063 | MGC133064 | SPBC110 | Spc110 ELKS/RAB6-interacting/CAST family member 2 Liprin-alpha2 interacts with ERC2. BIND 12923177
GIT1 - G protein-coupled receptor kinase interacting ArfGAP 1 Reconstituted Complex
2台混合动力		 BioGRID 12923177
GIT1 - G protein-coupled receptor kinase interacting ArfGAP 1 - HPRD 12629171
GIT1 - G protein-coupled receptor kinase interacting ArfGAP 1 Liprin-alpha2 interacts with GIT1. This interaction was modeled on a demonstrated interaction between human liprin-alpha2 and rat GIT1. BIND 12923177
PPFIA1 FLJ41337 | FLJ42630 | FLJ43474 | LIP.1 | LIP1 | LIPRIN | MGC26800 protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 - HPRD,BioGRID 9624153
PPFIA2 FLJ41378 | MGC132572 protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2 - HPRD,BioGRID 9624153
PPFIA3 KIAA0654 | LPNA3 | MGC126567 | MGC126569 protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3 - HPRD,BioGRID 9624153
PPFIBP1 L2 | hSGT2 | hSgt2p PTPRF interacting protein, binding protein 1 (liprin beta 1) - HPRD,BioGRID 9624153
PPFIBP2 Cclp1 | DKFZp781K06126 | MGC42541 PTPRF interacting protein, binding protein 2 (liprin beta 2) - HPRD,BioGRID 9624153
PPP2CA PP2Ac | PP2CA | RP-C protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform Affinity Capture-MS BioGRID 18782753
PPP2R1A MGC786 | PR65A protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform Affinity Capture-MS BioGRID 18782753
PTPRD HPTP | HPTP-DELTA | HPTPD | MGC119750 | MGC119751 | MGC119752 | MGC119753 | PTPD | R-PTP-DELTA protein tyrosine phosphatase, receptor type, D - HPRD,BioGRID 9624153
PTPRF FLJ43335 | FLJ45062 | FLJ45567 | LAR protein tyrosine phosphatase, receptor type, F - HPRD,BioGRID 9624153
PTPRS PTPSIGMA protein tyrosine phosphatase, receptor type, S - HPRD,BioGRID 9624153


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
ZHOU INFLAMMATORY RESPONSE LPS UP 431 237 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 30MIN DN 150 99 All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA NEURAL 129 85 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-130/301 65 71 1A hsa-miR-130abrain CAGUGCAAUGUUAAAAGGGCAU
hsa-miR-301 CAGUGCAAUAGUAUUGUCAAAGC
hsa-miR-130bbrain CAGUGCAAUGAUGAAAGGGCAU
hsa-miR-454-3p UAGUGCAAUAUUGCUUAUAGGGUUU
miR-148/152 21 27 1A hsa-miR-148a UCAGUGCACUACAGAACUUUGU
hsa-miR-152brain UCAGUGCAUGACAGAACUUGGG
hsa-miR-148b UCAGUGCAUCACAGAACUUUGU