Gene Page:PAQR8

Summary?
GeneID 85315
Symbol PAQR8
Synonyms C6orf33|LMPB1|MPRB
Description progestin and adipoQ receptor family member VIII
Reference MIM:607780|HGNC:HGNC:15708|Ensembl:ENSG00000170915|HPRD:07415|Vega:OTTHUMG00000014846
Gene type protein-coding
Map location 6p12.1
Pascal p-value 0.104
Sherlock p-value 0.593
TADA p-value 0.01
Fetal beta -1.983
eGene Cerebellar Hemisphere
小脑
Cortex
支持 CompositeSet

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
认为:Fromer_2014 Whole Exome Sequencing analysis This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
GSMA_IIE Genome scan meta-analysis (European-ancestry samples) Psr: 0.04433

Section I. Genetics and epigenetics annotation

@认为table

Gene Chromosome Position Ref Alt Transcript AA change Mutation type Sift CG46 Trait Study
PAQR8 chr6 52268171 G A NM_133367 p.54G>S missense Schizophrenia 认为:Fromer_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
WANG LMO4 TARGETS UP 372 227 All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN 848 527 All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION UP 195 138 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 2 473 224 All SZGR 2.0 genes in this pathway
ZHENG GLIOBLASTOMA PLASTICITY UP 250 168 All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS UP 395 249 All SZGR 2.0 genes in this pathway
YOSHIOKA LIVER CANCER EARLY RECURRENCE DN 65 31 All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP 397 206 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY 1725 838 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-124.1 1505 1511 m8 hsa-miR-124a UUAAGGCACGCGGUGAAUGCCA
miR-124/506 1504 1511 1A,m8 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brain UAAGGCACGCGGUGAAUGCC
miR-378 702 708 1A hsa-miR-378 CUCCUGACUCCAGGUCCUGUGU
miR-496 2913 2919 1A hsa-miR-496 AUUACAUGGCCAAUCUC